ID: 1199605086

View in Genome Browser
Species Human (GRCh38)
Location X:149571337-149571359
Sequence TTTGGCTTCCTAGCATAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199605086_1199605091 21 Left 1199605086 X:149571337-149571359 CCTCTTTATGCTAGGAAGCCAAA No data
Right 1199605091 X:149571381-149571403 GTCTGCTGCACCTATAGATTTGG No data
1199605086_1199605092 22 Left 1199605086 X:149571337-149571359 CCTCTTTATGCTAGGAAGCCAAA No data
Right 1199605092 X:149571382-149571404 TCTGCTGCACCTATAGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199605086 Original CRISPR TTTGGCTTCCTAGCATAAAG AGG (reversed) Intergenic
No off target data available for this crispr