ID: 1199606142

View in Genome Browser
Species Human (GRCh38)
Location X:149581173-149581195
Sequence GGTGCGCTTGAACACAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199606142_1199606148 23 Left 1199606142 X:149581173-149581195 CCTGCACTGTGTTCAAGCGCACC No data
Right 1199606148 X:149581219-149581241 CCTTCTATTCCTGCCCCAGGTGG No data
1199606142_1199606144 -7 Left 1199606142 X:149581173-149581195 CCTGCACTGTGTTCAAGCGCACC No data
Right 1199606144 X:149581189-149581211 GCGCACCGAGACAAGAGCGCGGG No data
1199606142_1199606143 -8 Left 1199606142 X:149581173-149581195 CCTGCACTGTGTTCAAGCGCACC No data
Right 1199606143 X:149581188-149581210 AGCGCACCGAGACAAGAGCGCGG No data
1199606142_1199606146 20 Left 1199606142 X:149581173-149581195 CCTGCACTGTGTTCAAGCGCACC No data
Right 1199606146 X:149581216-149581238 TTTCCTTCTATTCCTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199606142 Original CRISPR GGTGCGCTTGAACACAGTGC AGG (reversed) Intergenic
No off target data available for this crispr