ID: 1199606765

View in Genome Browser
Species Human (GRCh38)
Location X:149584781-149584803
Sequence TCTTAGATCTGGGGGCGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199606765_1199606776 2 Left 1199606765 X:149584781-149584803 CCCCCCCGCCCCCAGATCTAAGA No data
Right 1199606776 X:149584806-149584828 AGAGTTCACCTAGACTCTGTGGG No data
1199606765_1199606775 1 Left 1199606765 X:149584781-149584803 CCCCCCCGCCCCCAGATCTAAGA No data
Right 1199606775 X:149584805-149584827 CAGAGTTCACCTAGACTCTGTGG No data
1199606765_1199606782 24 Left 1199606765 X:149584781-149584803 CCCCCCCGCCCCCAGATCTAAGA No data
Right 1199606782 X:149584828-149584850 GGTGGCTTCTTTCTGCGTTGGGG No data
1199606765_1199606778 6 Left 1199606765 X:149584781-149584803 CCCCCCCGCCCCCAGATCTAAGA No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606765_1199606783 25 Left 1199606765 X:149584781-149584803 CCCCCCCGCCCCCAGATCTAAGA No data
Right 1199606783 X:149584829-149584851 GTGGCTTCTTTCTGCGTTGGGGG No data
1199606765_1199606777 3 Left 1199606765 X:149584781-149584803 CCCCCCCGCCCCCAGATCTAAGA No data
Right 1199606777 X:149584807-149584829 GAGTTCACCTAGACTCTGTGGGG No data
1199606765_1199606780 22 Left 1199606765 X:149584781-149584803 CCCCCCCGCCCCCAGATCTAAGA No data
Right 1199606780 X:149584826-149584848 GGGGTGGCTTCTTTCTGCGTTGG No data
1199606765_1199606781 23 Left 1199606765 X:149584781-149584803 CCCCCCCGCCCCCAGATCTAAGA No data
Right 1199606781 X:149584827-149584849 GGGTGGCTTCTTTCTGCGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199606765 Original CRISPR TCTTAGATCTGGGGGCGGGG GGG (reversed) Intronic