ID: 1199606778

View in Genome Browser
Species Human (GRCh38)
Location X:149584810-149584832
Sequence TTCACCTAGACTCTGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199606770_1199606778 1 Left 1199606770 X:149584786-149584808 CCGCCCCCAGATCTAAGAACAGA No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606769_1199606778 2 Left 1199606769 X:149584785-149584807 CCCGCCCCCAGATCTAAGAACAG No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606771_1199606778 -2 Left 1199606771 X:149584789-149584811 CCCCCAGATCTAAGAACAGAGTT No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606761_1199606778 23 Left 1199606761 X:149584764-149584786 CCATCCTTGATCAGGCCCCCCCC No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606773_1199606778 -4 Left 1199606773 X:149584791-149584813 CCCAGATCTAAGAACAGAGTTCA No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606763_1199606778 8 Left 1199606763 X:149584779-149584801 CCCCCCCCCGCCCCCAGATCTAA No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606762_1199606778 19 Left 1199606762 X:149584768-149584790 CCTTGATCAGGCCCCCCCCCGCC No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606774_1199606778 -5 Left 1199606774 X:149584792-149584814 CCAGATCTAAGAACAGAGTTCAC No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606765_1199606778 6 Left 1199606765 X:149584781-149584803 CCCCCCCGCCCCCAGATCTAAGA 0: 2
1: 0
2: 2
3: 33
4: 283
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606768_1199606778 3 Left 1199606768 X:149584784-149584806 CCCCGCCCCCAGATCTAAGAACA No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606764_1199606778 7 Left 1199606764 X:149584780-149584802 CCCCCCCCGCCCCCAGATCTAAG No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606767_1199606778 4 Left 1199606767 X:149584783-149584805 CCCCCGCCCCCAGATCTAAGAAC No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606772_1199606778 -3 Left 1199606772 X:149584790-149584812 CCCCAGATCTAAGAACAGAGTTC No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data
1199606766_1199606778 5 Left 1199606766 X:149584782-149584804 CCCCCCGCCCCCAGATCTAAGAA No data
Right 1199606778 X:149584810-149584832 TTCACCTAGACTCTGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199606778 Original CRISPR TTCACCTAGACTCTGTGGGG TGG Intronic