ID: 1199608108

View in Genome Browser
Species Human (GRCh38)
Location X:149592760-149592782
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199608101_1199608108 -1 Left 1199608101 X:149592738-149592760 CCCCAGCAGCCACTAGGGTCACC 0: 2
1: 0
2: 0
3: 15
4: 207
Right 1199608108 X:149592760-149592782 CGGTACCCAGAGATGGCAAAAGG 0: 2
1: 0
2: 0
3: 12
4: 116
1199608098_1199608108 23 Left 1199608098 X:149592714-149592736 CCATGGAGGCAGCAGGCTGTGCA 0: 2
1: 0
2: 4
3: 39
4: 331
Right 1199608108 X:149592760-149592782 CGGTACCCAGAGATGGCAAAAGG 0: 2
1: 0
2: 0
3: 12
4: 116
1199608103_1199608108 -3 Left 1199608103 X:149592740-149592762 CCAGCAGCCACTAGGGTCACCGG 0: 2
1: 0
2: 0
3: 2
4: 104
Right 1199608108 X:149592760-149592782 CGGTACCCAGAGATGGCAAAAGG 0: 2
1: 0
2: 0
3: 12
4: 116
1199608102_1199608108 -2 Left 1199608102 X:149592739-149592761 CCCAGCAGCCACTAGGGTCACCG 0: 2
1: 0
2: 0
3: 4
4: 116
Right 1199608108 X:149592760-149592782 CGGTACCCAGAGATGGCAAAAGG 0: 2
1: 0
2: 0
3: 12
4: 116
1199608105_1199608108 -10 Left 1199608105 X:149592747-149592769 CCACTAGGGTCACCGGTACCCAG 0: 2
1: 0
2: 0
3: 2
4: 76
Right 1199608108 X:149592760-149592782 CGGTACCCAGAGATGGCAAAAGG 0: 2
1: 0
2: 0
3: 12
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900301715 1:1981261-1981283 CAGTGCCCAGAGACGACAAAAGG + Intronic
900371312 1:2333370-2333392 GGGTCCCCAGCGATGGCAACTGG + Intronic
902782007 1:18711042-18711064 AGAGACCCAGAGAAGGCAAAGGG - Intronic
904205321 1:28850957-28850979 GGGATCCCAGAGAAGGCAAAGGG + Intronic
905024322 1:34839475-34839497 CAGTTCCCAGAGAAGGCACATGG - Intronic
906662424 1:47592697-47592719 CGGCACCCAGAGTGGGCAAGGGG - Intergenic
907365389 1:53954715-53954737 CAGTATCCAGACATCGCAAATGG - Intronic
908107115 1:60856378-60856400 CTGTACCCAGAGAAATCAAATGG - Intergenic
912606388 1:110993575-110993597 AGGTACCCAAAGAGGGTAAAGGG - Intergenic
912730780 1:112101210-112101232 AGGAACCAAGAGATGGAAAAAGG + Intergenic
915739116 1:158104645-158104667 CGAGGCCCAGAGAAGGCAAATGG - Intergenic
917779109 1:178372306-178372328 CCGTACCCAGAAATGACAGAAGG - Intronic
921078921 1:211723321-211723343 CTTTACCCAGAGATGACACATGG - Intergenic
1065139914 10:22710319-22710341 CAGTCCCCAGAGAGGGGAAAGGG - Intronic
1066268680 10:33800795-33800817 AGGTACCCAGTGATGACAAGGGG - Intergenic
1075797454 10:125130867-125130889 TGCCACCCAGAGAGGGCAAAGGG + Intronic
1075920859 10:126211515-126211537 CAGGACCCAGAGATGGCTACTGG - Intronic
1079967278 11:26994596-26994618 CTCTACCCAGAGATGTCCAATGG + Exonic
1084150779 11:67287007-67287029 CTGAAGCCAGAGATGGCCAAGGG - Intergenic
1085217503 11:74845173-74845195 CGGCACCCAGAGAGGTGAAAGGG - Exonic
1089423837 11:118353214-118353236 AGGTTCCCAGAGATGACAAATGG + Exonic
1093754131 12:22833340-22833362 CTGTATCCTGACATGGCAAAGGG - Intergenic
1098648730 12:72939031-72939053 CTGTACCCAGAAAAGCCAAAGGG - Intergenic
1104201201 12:126591120-126591142 TTGCACCCAGATATGGCAAATGG + Intergenic
1110748005 13:79079078-79079100 GGGAACCCAGAGATCCCAAAGGG - Intergenic
1114655722 14:24314570-24314592 TGGTAGCCAGAGAAGGGAAATGG - Exonic
1117470642 14:56040967-56040989 CGGTACCCAGTGAAGACAAAAGG - Intergenic
1117621404 14:57590790-57590812 CGCAGCCCAGAGATTGCAAATGG + Intronic
1124354458 15:28984637-28984659 CAGCACCCAGAGATGGCAGTGGG - Intronic
1125501600 15:40243065-40243087 TTGGACCCAGAGTTGGCAAAAGG - Intronic
1125537019 15:40446969-40446991 AGGTAACCAGAGTTGGAAAAGGG - Intronic
1127902768 15:63353444-63353466 CAGGACCCAGACCTGGCAAAGGG - Intronic
1131868726 15:96739259-96739281 CTGTACCAAGAGAATGCAAAAGG + Intergenic
1132396495 15:101478787-101478809 AGGTACCAAGAGATGTCAAAGGG + Intronic
1132615582 16:839796-839818 CGGTACCGAGAGAGGGCTGAGGG + Intergenic
1133878351 16:9756870-9756892 CGGGGCAAAGAGATGGCAAAAGG - Intronic
1137661925 16:50214754-50214776 TGGTACAGAGAGATGGAAAAGGG + Intronic
1138058787 16:53865306-53865328 ATGTCCTCAGAGATGGCAAACGG + Intronic
1138104307 16:54279397-54279419 CAGTATCCAGAGAGGTCAAAGGG + Intergenic
1141324996 16:83048620-83048642 GGGTACTCAGAGATGGAAAAGGG - Intronic
1142925781 17:3234910-3234932 TGTTACACAGAGATGTCAAATGG - Intergenic
1145000600 17:19302026-19302048 CGGGGCCCAGAGAGGGTAAATGG - Intronic
1149915617 17:60606072-60606094 AGGTTACCAGAGATGGGAAAGGG - Intronic
1151335960 17:73439867-73439889 CAGAACCCAGAGAGGGCAAGTGG - Intronic
1151577819 17:74961787-74961809 CGAGACCCAGAGCTGGCGAATGG + Intronic
1154140876 18:11823043-11823065 AGGTGCCCAGAGCTGGCAACTGG + Intronic
1157898994 18:51495440-51495462 GGGAACCCAGAGATGGAGAATGG - Intergenic
1161069547 19:2253304-2253326 CGGTCCCCAGAGAGGGCGCAGGG + Intronic
1161181735 19:2888188-2888210 CGATACACAGATCTGGCAAAGGG + Intergenic
1161905378 19:7152618-7152640 TGGGACCCAGAGACGGCAGAAGG - Intronic
1162877702 19:13633031-13633053 TGGTAGCCAGAGAAGGAAAAAGG - Intergenic
1163387157 19:17006821-17006843 CAAAACTCAGAGATGGCAAATGG - Intronic
1164793018 19:31003920-31003942 TGGTACCCAGCCATGGCAATTGG + Intergenic
1165924481 19:39318725-39318747 CGGTACCAAGAGCTGGGGAAGGG + Intergenic
1166234638 19:41446619-41446641 GGGGACCCAGAGAAGGCAACAGG + Intergenic
1167015591 19:46838984-46839006 CGATGCAAAGAGATGGCAAAAGG + Intronic
927150053 2:20190323-20190345 CGGTTCCCAGGCATGGGAAAGGG - Intergenic
928098994 2:28423804-28423826 GGGTACCCAGAGCTGGGCAAAGG - Intergenic
928906477 2:36373517-36373539 CTGTACCCAAAGATGGCACTTGG + Intronic
929098785 2:38289185-38289207 AGGAAACCGGAGATGGCAAAAGG - Intergenic
930825444 2:55692894-55692916 CGATGCAAAGAGATGGCAAAAGG - Intronic
934533774 2:95115180-95115202 TGGTTCCCAGTGATGACAAATGG + Exonic
935929506 2:108108499-108108521 CAGTAAACAGAGAGGGCAAAAGG + Intergenic
942088732 2:172467210-172467232 AGGTATCAAGAGAGGGCAAAGGG + Intronic
942142182 2:172988562-172988584 CTGTACCTAGCGATGCCAAAGGG - Intronic
947897859 2:233692206-233692228 GGGCACCCAGAGATGGCAGATGG + Intronic
1170807721 20:19647496-19647518 TGGTACCCAGAGTGGGCGAAGGG + Intronic
1171258503 20:23710354-23710376 CTGTACCCTGAAATGGCAAAGGG + Intergenic
1171749601 20:29035964-29035986 TGGTTCCCAGTGATGGGAAAGGG - Intergenic
1172259750 20:33552828-33552850 AGGAACCCTGAGATGGTAAAAGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176315636 21:5240036-5240058 CGGTTCCCAGTGATGGGAAAGGG + Intergenic
1176946342 21:14987037-14987059 AGATATCCAGAGATAGCAAATGG - Intronic
1180195396 21:46190805-46190827 CCGTGCCCAGAGGTGGCAGAAGG + Exonic
1180393430 22:12305989-12306011 CGGTTCCCAGTGATGGGAAAGGG + Intergenic
1180406318 22:12558779-12558801 CGGTTCCCAGTGATGGGAAAGGG - Intergenic
1183238394 22:36637520-36637542 CGGTATCTGGAGACGGCAAAGGG + Intronic
1184787754 22:46680082-46680104 GGGTACCCAGGGCTGGCACAGGG + Intergenic
949398674 3:3642364-3642386 CAGGGCCCAGAGATGGCAGAGGG + Intergenic
950580002 3:13855836-13855858 TGGAACCCAGAGCAGGCAAAGGG + Intronic
950591157 3:13936349-13936371 CAGTACACAGAGATGGAAACAGG - Intergenic
953237173 3:41117166-41117188 CGGGCCCCAGAGGTGGCAGAAGG - Intergenic
956098025 3:65737787-65737809 CTCTACCCACATATGGCAAATGG + Intronic
956305989 3:67826034-67826056 CAGTAACCATACATGGCAAATGG + Intergenic
956421851 3:69094083-69094105 CCTCACCCTGAGATGGCAAAAGG + Intronic
958593063 3:96184985-96185007 AGTTACCAAGAGATGGCAGAAGG + Intergenic
964885879 3:161481861-161481883 GGAGACCCAGAGATGGCAACGGG - Intergenic
965001847 3:162964107-162964129 CAGGAAACAGAGATGGCAAAAGG - Intergenic
967583949 3:191190140-191190162 GGGGACCCATAGTTGGCAAAAGG - Intergenic
972299190 4:37769132-37769154 AGGTACCCAGGGAAGGAAAAAGG - Intergenic
974645824 4:64690683-64690705 CAGTACCTAGTGATGGTAAATGG - Intergenic
979488850 4:121300928-121300950 TGGAACCCAAAGATGGCAATAGG + Intergenic
979499982 4:121428575-121428597 TGGTGCACAGAGAAGGCAAAAGG + Intergenic
985003461 4:185508580-185508602 CGTTACACAGAGATGGCACCGGG + Intronic
985431480 4:189885516-189885538 CAGTTCCCAGTGATGGGAAAGGG - Intergenic
986330222 5:6712471-6712493 CGGGACACCGGGATGGCAAACGG + Intergenic
994812555 5:104540200-104540222 CTGGACCCAGAGAAGGCAGAAGG - Intergenic
995528711 5:113072062-113072084 CTGTACCCTGAGATGGAAAACGG - Intronic
996023122 5:118613617-118613639 AGGTACCCAGTGATGGGAAGGGG - Intergenic
996777049 5:127143775-127143797 TGGTTCCCAGTGATGACAAAGGG + Intergenic
997196421 5:131983264-131983286 CTGTACCCAGTGATGGCTGAGGG - Intronic
1001241618 5:170075783-170075805 CGGTCCCCAGCCATGGGAAATGG - Intronic
1001386071 5:171339706-171339728 CGGTACCCACAGATACCAAAAGG + Intergenic
1003130039 6:3387580-3387602 CGGTCCCCAGAGCTGAGAAACGG - Intronic
1004096490 6:12560156-12560178 CCGAATCCAGGGATGGCAAATGG + Intergenic
1005994893 6:30925240-30925262 GGGGACCCAGAATTGGCAAAGGG - Intronic
1015097722 6:129435997-129436019 TGGTACCCAGAGAAGGCAGGTGG - Intronic
1017073279 6:150595694-150595716 AGGGACCAAGAGATGGAAAAAGG - Intergenic
1023762348 7:43478092-43478114 TGGTACTCAGACATGGCACAAGG + Intronic
1025171495 7:56761359-56761381 TGGCACCCAAAGATGACAAAAGG + Intergenic
1025700369 7:63814123-63814145 TGGCACCCAAAGATGACAAAAGG - Intergenic
1025831922 7:65059766-65059788 TGGCACCCAAAGATGACAAAAGG - Intergenic
1025919609 7:65899193-65899215 TGGCACCCAAAGATGACAAAAGG - Intronic
1031456408 7:121985750-121985772 CCATACCCATAGATGGTAAATGG + Intronic
1033849457 7:145477634-145477656 AGGTACACAGAGATGATAAAGGG + Intergenic
1034832710 7:154323581-154323603 CTTACCCCAGAGATGGCAAATGG - Intronic
1039438770 8:37580124-37580146 CCGCACCCAGAGATGGGACAGGG + Intergenic
1042035834 8:64533028-64533050 CGAAACACACAGATGGCAAATGG + Intergenic
1042738252 8:72012827-72012849 AGGGACACAGAGATGGCTAAAGG + Intronic
1047772556 8:128042043-128042065 CAGTACCAAGAGATGCTAAATGG - Intergenic
1049592962 8:143470982-143471004 CGGTGCCCAGAGCTGGCACTGGG - Intronic
1053720650 9:40943561-40943583 TGGTTCCCAGTGATGGGAAAGGG - Intergenic
1054345337 9:63908594-63908616 TGGTTCCCAGTGATGGGAAAGGG + Intergenic
1057517359 9:95733353-95733375 CGTTGGCCAGAGATGACAAAGGG - Intergenic
1061156071 9:128862578-128862600 CAGTGCCCAGAGAAGGCAAGGGG - Intronic
1061262755 9:129488989-129489011 CGAGGCCCAGAGATGGCAAAAGG + Intergenic
1188713216 X:33428166-33428188 CTGTCCCCAGAGATGGAGAATGG - Intergenic
1192282076 X:69698147-69698169 AGGAAGCCAAAGATGGCAAAAGG - Intronic
1199608108 X:149592760-149592782 CGGTACCCAGAGATGGCAAAAGG + Exonic
1199631012 X:149776600-149776622 CGGTACCCAGAGATGGCAAAAGG - Exonic