ID: 1199610224

View in Genome Browser
Species Human (GRCh38)
Location X:149606513-149606535
Sequence CTGTGGGAGTTGAGAAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 11, 3: 41, 4: 484}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199610224_1199610230 8 Left 1199610224 X:149606513-149606535 CCCTCTCTTCTCAACTCCCACAG 0: 1
1: 0
2: 11
3: 41
4: 484
Right 1199610230 X:149606544-149606566 TTTCCACCTTGTGCTCCCGTCGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199610224 Original CRISPR CTGTGGGAGTTGAGAAGAGA GGG (reversed) Intronic
900626782 1:3611967-3611989 CCGTGGGACTTGAGAAGTGAGGG - Intergenic
900743247 1:4343313-4343335 GTGTGGGAGGTGAGAAGAAAAGG - Intergenic
902497398 1:16883046-16883068 CTGTGGGATGTGACAAGAGAAGG + Intronic
902559150 1:17266269-17266291 CCCTGGGAGTTAAGAGGAGAAGG + Intronic
902672045 1:17981416-17981438 CTGGAGCAGGTGAGAAGAGAGGG - Intergenic
903746487 1:25590312-25590334 CTGTGGTAGTTTAGCAGAGCTGG - Intergenic
904376426 1:30085198-30085220 GTGTGGGAGATGAGGAAAGAAGG - Intergenic
904418764 1:30378208-30378230 CAGTGGGTGGTGGGAAGAGATGG + Intergenic
904426004 1:30423603-30423625 CTGTGAGGACTGAGAAGAGAAGG - Intergenic
904524411 1:31121922-31121944 GTGTGGGAGATGAACAGAGAAGG + Intergenic
904629722 1:31831771-31831793 GTGTGGGAGTGAAGAAGATAAGG - Intergenic
904757373 1:32775530-32775552 CTGTGGGATTTGAAAAGGAAAGG - Exonic
906245188 1:44268419-44268441 CTGGGGCACTAGAGAAGAGATGG - Intronic
906527499 1:46503796-46503818 GTGTGGGAGGTGAAAAGGGAAGG - Intergenic
906795002 1:48689684-48689706 CTGTGTGTGTTGGGATGAGATGG + Intronic
906855701 1:49302082-49302104 TTGGGGGAGAGGAGAAGAGAAGG - Intronic
906946009 1:50295021-50295043 TTTTGTGAGTTTAGAAGAGAGGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907787984 1:57632629-57632651 GTGTGAGAGTTGTGAGGAGAAGG + Intronic
907874663 1:58473863-58473885 CTGTCGGAGTTGAAATGTGAAGG - Intronic
909125581 1:71664538-71664560 CCATGGGAATTTAGAAGAGAAGG + Intronic
909224748 1:73005355-73005377 CTGTGAGATTTGAAAAGAGCTGG - Intergenic
910574237 1:88740942-88740964 ATGTGGGAGTTTAGGAGAGTTGG - Intronic
910939197 1:92515025-92515047 CAGGGGGAGTTGGGGAGAGAAGG - Intronic
911098548 1:94075918-94075940 CTGAGAGAGGTGTGAAGAGAGGG + Intronic
911213268 1:95164994-95165016 ATGTGGGAGCTGGGAAAAGACGG - Intronic
911857719 1:102902075-102902097 CAGTGTGAGTTGATGAGAGAGGG + Intronic
913162029 1:116153134-116153156 GAGAGGGAGTTGAGCAGAGAGGG + Intergenic
913679620 1:121176803-121176825 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914031454 1:143964450-143964472 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914157993 1:145103514-145103536 CAATGGGAGTTGAGAGGAGGAGG + Intronic
915247283 1:154565397-154565419 CTGGGGGATTTGAGAAGAGAAGG + Intergenic
915516028 1:156413221-156413243 CTGTGGGAACAGAGAAGAGGAGG - Intronic
915913401 1:159928057-159928079 GGGTGGGAGTGGAGCAGAGAAGG + Intronic
918337841 1:183538668-183538690 CTTAGGGAGGTGAGAAGGGATGG - Intronic
918522115 1:185426158-185426180 GTGTGGGAGTTTAAGAGAGAAGG - Intergenic
918860274 1:189816177-189816199 CTATAGGAATTGAGAAGAAATGG + Intergenic
919483803 1:198121527-198121549 AAGTGGGAGGTGAGAAAAGAAGG - Intergenic
919651255 1:200150945-200150967 CCGTGGGAGTTAAGAATTGAAGG + Intronic
920466926 1:206195347-206195369 CAATGGGAGTTGAGAGGAGGAGG - Intronic
920838575 1:209534735-209534757 CTGTGGGAGGTGAGAGGACTGGG - Intergenic
920845754 1:209591882-209591904 CTGGGGTTGGTGAGAAGAGACGG - Intronic
921154561 1:212429063-212429085 CTGTGGGACTTCATAAGAAATGG - Intergenic
921859140 1:220022861-220022883 TTCAGGGAGATGAGAAGAGAAGG - Intronic
921988008 1:221333724-221333746 GTGTGGGAGTGGAAAAGGGAAGG + Intergenic
922052839 1:222010662-222010684 GAGTGGGAGATGAGAAGGGAAGG - Intergenic
922056475 1:222046616-222046638 CTCAGGGAGTTGGGAAGAGTTGG - Intergenic
922135699 1:222823878-222823900 CTATAGGAGTTGAGAAGAGGAGG + Intergenic
922427168 1:225509460-225509482 CTGTGGAAGCTGAGAAGCAAGGG + Intronic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
922900814 1:229135107-229135129 CTGTGGGAGCTGTGAGAAGAGGG + Intergenic
922928431 1:229370270-229370292 CTGTGCTAGTTCAGAAGAGCAGG - Intergenic
923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG + Intronic
923629397 1:235640004-235640026 CTGTGGGAGGGGAGCAGTGAGGG + Intronic
923687564 1:236163940-236163962 GTGTGGGAGGTGGGAGGAGATGG - Intronic
924284694 1:242474458-242474480 CAGTGGGAATTGAGAAGAAAGGG - Intronic
1063611924 10:7570064-7570086 CTTTGAGAGGTGAGAGGAGAAGG + Intronic
1064527334 10:16270917-16270939 CTGTCTGAGTGGGGAAGAGAAGG - Intergenic
1065963132 10:30750400-30750422 CTGTAGGAGTTCAGAAAAGGGGG + Intergenic
1066049594 10:31621450-31621472 CTGTGGGAGTTGTGATGTGACGG + Intergenic
1066153381 10:32649152-32649174 CTGTGGGAGTTGTGGTGGGAGGG + Intronic
1066291981 10:34022682-34022704 ATGTGGGGATTGTGAAGAGATGG - Intergenic
1067095236 10:43295273-43295295 TTGTGGGAGGTGAGGAGTGAAGG - Intergenic
1068383068 10:56284175-56284197 ATGTGAGTATTGAGAAGAGAAGG - Intergenic
1068689817 10:59904550-59904572 GAGTGGGGGTTAAGAAGAGAGGG - Intronic
1068971341 10:62961475-62961497 CTGTGTGAGTTCTGAAGCGAGGG - Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069861140 10:71472449-71472471 CTGTTAGAGCTGCGAAGAGAGGG - Intronic
1070637901 10:78143861-78143883 CTGTGGTAGCTGGGAAGAGGTGG + Intergenic
1071268286 10:83983784-83983806 CTGTGGGAGGTGGGAAGAGAGGG - Intergenic
1072682399 10:97516788-97516810 CTGTAGGAGATGCGAGGAGATGG - Intronic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1073514088 10:104061708-104061730 CTGTAGGAGTTCAGGAGAGAAGG - Intronic
1074421130 10:113309652-113309674 TGGGGGGAGGTGAGAAGAGAAGG - Intergenic
1074743833 10:116510831-116510853 CCGTGAGATTGGAGAAGAGAAGG + Intergenic
1074753072 10:116605759-116605781 CTGTGGGAATACAGAAGATAAGG + Intronic
1074755631 10:116622086-116622108 CTGGCGGGGTTGAGAAGACAAGG - Intronic
1074810221 10:117097247-117097269 CTGTCGGGGTTGAGCAGAGTGGG - Intronic
1075076537 10:119354891-119354913 CTATGGGAGTTGAGAATGCATGG + Intronic
1075157536 10:119990304-119990326 CTGTCAGAGGTGAGAAGAGCAGG + Intergenic
1075262081 10:120971858-120971880 CCGGGGGAGTTGAGAACAGGTGG - Intergenic
1076150222 10:128155862-128155884 CTCTGGGATTGGAGAAGGGAAGG - Intergenic
1076482303 10:130792623-130792645 CTGTGGGAGCCGCGAAGGGAAGG + Intergenic
1076619129 10:131775793-131775815 AGGTGGGAGTGGAGAGGAGAAGG + Intergenic
1076731998 10:132443918-132443940 GAGTGGGGGTTGAGAGGAGAGGG - Intergenic
1077093088 11:788350-788372 CTGTGGTTGTTGAGAAGGGCAGG + Exonic
1077225301 11:1436859-1436881 CAGTGGGAGTGGCCAAGAGAGGG + Intronic
1077356897 11:2122840-2122862 GTGTGGGAGCTGGGAAGAGCGGG + Intergenic
1078081761 11:8209289-8209311 CTCTGGGAGTTACCAAGAGAGGG + Intergenic
1078709670 11:13778869-13778891 CTGTGGGAGTTGACATCAAAAGG + Intergenic
1079119533 11:17672095-17672117 TGGTGGGAGATGAGAAGAAAAGG + Intergenic
1080242512 11:30142934-30142956 CCTTGTGAGTTGAGAAGGGATGG + Intergenic
1080271202 11:30452390-30452412 CTGTGGGAATGGAGAAGGTATGG - Intronic
1080685447 11:34511544-34511566 CTGTGGGAGTGAGGCAGAGATGG + Exonic
1080698656 11:34625068-34625090 CTGTGAGAGCTGAGAACAGGTGG + Intronic
1080885796 11:36366916-36366938 CTGTGGGAGAAGGGAGGAGAAGG - Intronic
1080938862 11:36891835-36891857 CTATAGTTGTTGAGAAGAGAAGG + Intergenic
1081612150 11:44569039-44569061 CTGTGAGAGGTGGGAAGGGAGGG + Intronic
1081691026 11:45078673-45078695 CTGTAGGAGTGAATAAGAGAAGG - Intergenic
1081914195 11:46720282-46720304 CTGGGGGAGATGGGAGGAGAGGG - Intronic
1083433872 11:62629685-62629707 CTGGGTGAGGAGAGAAGAGACGG + Intronic
1083919896 11:65776820-65776842 CCTTGGGAGTTGAGAAGCGCTGG + Exonic
1085258531 11:75191012-75191034 CTGTGGATGCTGAGGAGAGATGG + Intronic
1087162047 11:94958669-94958691 CTTTAGGAGGTGAGAGGAGAAGG - Intergenic
1087535465 11:99439220-99439242 CTGTTGGAGGAGAGCAGAGAAGG + Intronic
1089539501 11:119181488-119181510 CTGGGGGAGGTGGGGAGAGAGGG + Intronic
1090020458 11:123123845-123123867 CTGTGGCAGCTCAGAGGAGATGG + Intronic
1090311557 11:125745844-125745866 CTCTAGGAATGGAGAAGAGAGGG - Intergenic
1090339339 11:126002751-126002773 CTGAGTGAGCTGAGAAGAGCTGG - Intronic
1091014200 11:132035219-132035241 CTATGGAAGTAGAGAAAAGAGGG - Intronic
1091021287 11:132102515-132102537 CTCAGGGTGGTGAGAAGAGATGG + Intronic
1091034984 11:132224739-132224761 TAGTGGGAGTGGAGAAGAGAGGG + Intronic
1091396502 12:156852-156874 CTGTGGCAGGTGGGAGGAGATGG + Intronic
1091883503 12:3999209-3999231 CTGAGTGACTGGAGAAGAGAAGG + Intergenic
1092598851 12:10036569-10036591 CTGTGGATGTGTAGAAGAGAAGG - Intronic
1093084384 12:14850790-14850812 TTGTGGGAGTAGAGGAGAAAGGG + Intronic
1095397409 12:41776601-41776623 CTGGGGGAGTGGAGAAGGGCTGG - Intergenic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097528820 12:60772893-60772915 CTGTGGGGGTTGAGGAGGGAAGG + Intergenic
1097889220 12:64760268-64760290 CGGTGGGCGGTGAGAGGAGAGGG - Intergenic
1098900850 12:76110616-76110638 TTGAGGGAGCAGAGAAGAGAGGG + Intergenic
1100061439 12:90581378-90581400 CTGTTGCACTTGAGAAGAGCTGG - Intergenic
1100373806 12:93993877-93993899 CTGTGAGAGGTGAGGAGGGAAGG + Intergenic
1100856125 12:98758722-98758744 CTGGGGAAGAAGAGAAGAGAAGG - Intronic
1101892481 12:108730384-108730406 CGGTGAGAGCTGAGAAGAAAGGG - Intronic
1102360030 12:112277710-112277732 CTGTGTGATGTGAGAAGAGATGG - Intronic
1102397233 12:112597178-112597200 CTGTGATTGTTGAGAAAAGACGG + Intronic
1102648591 12:114420057-114420079 AGGAGGGAGGTGAGAAGAGATGG + Intergenic
1103451363 12:121031593-121031615 GGCTGGGAGTTGGGAAGAGAAGG + Exonic
1103562947 12:121801474-121801496 GTTTGGGAGCTGAGAGGAGAAGG - Intronic
1104062552 12:125280864-125280886 ATTTGGGAGTTGAGAGGAGGGGG + Intronic
1104155238 12:126125296-126125318 CTCAGGGAGTGGTGAAGAGAAGG - Intergenic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1105849722 13:24323209-24323231 CTGTGGTTGTTGAGAAGGGCGGG - Intergenic
1106333067 13:28756945-28756967 CAGTGAGAGTAGAGGAGAGAAGG - Intergenic
1108059220 13:46515832-46515854 CTGTGGGAGTTGGCATGGGAAGG - Intergenic
1108450520 13:50558187-50558209 CTATAGGAGTTGAGAGCAGAGGG + Intronic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1109609671 13:64747548-64747570 CTGTGGGAGTACAGACTAGAGGG - Intergenic
1109633941 13:65088587-65088609 CTGTGTGAGTAAAGAAGGGAAGG + Intergenic
1109747696 13:66647926-66647948 CTGTGGGCCTGGGGAAGAGACGG + Intronic
1110035971 13:70684365-70684387 GTGTGGGAGTGGGGAAGAGGAGG + Intergenic
1110297790 13:73888555-73888577 CTGTGTTAGTTAAAAAGAGAAGG + Intronic
1110719299 13:78743694-78743716 ATGTGGGAGGTGAGAAGGGAGGG + Intergenic
1110823160 13:79939989-79940011 ATGTGGGAGTGAAGAAAAGAAGG + Intergenic
1111908990 13:94289210-94289232 CTGTCGGACTTGAGAAGGCATGG - Intronic
1112245000 13:97725242-97725264 CTGTTGGAGCAGAGAAGAGCAGG + Intergenic
1112336686 13:98522396-98522418 ATATGGGAGTTCAGAAGAGGAGG + Intronic
1112431491 13:99354493-99354515 CTGTGGAAGTTCAGCAGAGCAGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112589641 13:100751343-100751365 CTGGGGGCTTTGAGGAGAGAAGG + Intergenic
1113064631 13:106360529-106360551 CTCTGGGATTTGGGAAGGGAGGG + Intergenic
1113301060 13:109019690-109019712 TTCTGAGAGTTAAGAAGAGATGG - Exonic
1113579355 13:111418222-111418244 GTGTGGAAGCTGAGATGAGAGGG - Intergenic
1114458973 14:22875032-22875054 CTATGGGAGTAGAGGAGAGCAGG - Intronic
1116611243 14:47074849-47074871 CTCAGAGAGTTGAGAACAGAGGG - Intronic
1116779837 14:49224902-49224924 CTGTGGAAGAAGAGAAAAGATGG + Intergenic
1118010348 14:61604489-61604511 CTGTGGCAGCAGAGGAGAGATGG + Intronic
1118492293 14:66272964-66272986 CAGTGGGATTTTAGAAGGGATGG - Intergenic
1118880333 14:69820121-69820143 CTGTTAGAGGTGGGAAGAGAAGG + Intergenic
1119045994 14:71319864-71319886 GTTTGCGAGTTGAGAAGAGGAGG + Intergenic
1119112873 14:71991337-71991359 ATGTGGAAGATGAGGAGAGAGGG - Intronic
1119180515 14:72601914-72601936 CTATGAGAGTTCAGAAGGGAGGG - Intergenic
1120064690 14:80027359-80027381 CTGTGGCAATTGTGAACAGAGGG - Intergenic
1120215853 14:81679911-81679933 CTGTGGGACTTCAGAGGAAATGG + Intergenic
1120518332 14:85496207-85496229 ATGTGGGAGTAGAGACCAGAGGG - Intergenic
1120915781 14:89708879-89708901 CTGTTAGAATTGAGAAGAGATGG + Intergenic
1121403309 14:93701968-93701990 GTGAGGGACTTGAGAAGAGTAGG - Intronic
1121435212 14:93914783-93914805 CTGAGGCAGTGGAGAAGAGATGG - Intergenic
1121586629 14:95067463-95067485 CTGAGGGAAGTGAGCAGAGAGGG - Intergenic
1121869207 14:97391777-97391799 CTGACGGAGTTGGCAAGAGATGG - Intergenic
1122276097 14:100591536-100591558 CTTTGGGAGCTGAGATGAGGAGG - Intergenic
1122557648 14:102590334-102590356 CTGTGGGAGGTGTAAGGAGAGGG + Intergenic
1122685086 14:103500305-103500327 CTGTAGGAGTTACGTAGAGAGGG + Intronic
1124910077 15:33911153-33911175 CTGTGAGTGATGAGAAGAGGTGG - Intronic
1125471505 15:40008746-40008768 CTGTGAGAGTTGAGAAGAAAAGG - Intronic
1125507086 15:40273142-40273164 TCTTGGGAGTGGAGAAGAGAAGG + Intronic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128498345 15:68210744-68210766 CTCTGGGAGTTCTGAAGAGGGGG + Intronic
1128737582 15:70061954-70061976 CTGGGAAAGTGGAGAAGAGAAGG - Intronic
1128743875 15:70100423-70100445 ATTTGGGAGCTGAGAGGAGAGGG + Intergenic
1128990314 15:72254163-72254185 CTTAGGGAGTTAAGAAGTGAAGG - Intronic
1130284679 15:82545002-82545024 CTGTAGGAGGTGAGAAGGGCAGG - Intronic
1130422508 15:83762581-83762603 CGGTGGGAGGGCAGAAGAGAGGG + Intronic
1130454188 15:84088689-84088711 CAGTGGGATCTGAGGAGAGATGG + Intergenic
1130908980 15:88257997-88258019 CTGTGGGAAAGGAGAAGAAAGGG + Intergenic
1131937130 15:97519095-97519117 CAGTGGGAGTGGGGAATAGATGG + Intergenic
1132175176 15:99708265-99708287 CTCTGAGAATTGAGAAGGGAGGG + Intronic
1132999127 16:2840431-2840453 GTTTGGGAGTTGAGAAGAGCAGG - Intergenic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1134188294 16:12101014-12101036 TCCTGGGAATTGAGAAGAGATGG - Intronic
1134909293 16:18009573-18009595 CTGTGAGAGCTGATAGGAGATGG + Intergenic
1135880519 16:26251259-26251281 CTGAGGGAGCAGAGAAAAGAAGG - Intergenic
1137400669 16:48151928-48151950 TTGTGGGAGGTGAGACTAGAAGG + Intronic
1138099561 16:54241689-54241711 CACTGGGAGTGGAGAAGGGATGG - Intergenic
1138344554 16:56311976-56311998 CTCTGGGAGCTGAGAAGAGCAGG + Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1140930478 16:79623103-79623125 CTGTGGGAGGGGACAAGAGGTGG - Intergenic
1141675916 16:85517240-85517262 CTGTGGGAGGCGGGAGGAGATGG + Intergenic
1141833111 16:86520701-86520723 CTCACGAAGTTGAGAAGAGAGGG - Intergenic
1142491011 17:279664-279686 CTGTGGGAGGGCAGAAGTGAGGG - Intronic
1142526952 17:549655-549677 GTGTGGCAGTTCAGGAGAGATGG + Intronic
1144279309 17:13708932-13708954 TTGTGGGATGTGAGAACAGAGGG + Intergenic
1145014592 17:19387893-19387915 CTGTGGGAGGGGAAAAGAGTGGG - Intergenic
1145030959 17:19504946-19504968 CTGTGGGTGTTGTGAAGGGGTGG + Intronic
1146684201 17:34829644-34829666 AAATAGGAGTTGAGAAGAGAGGG + Intergenic
1146806983 17:35872465-35872487 CTGTGGGAGAGGAGAAGAAGAGG + Intronic
1147031966 17:37645759-37645781 ATGTGTGAATGGAGAAGAGAAGG + Intergenic
1148150426 17:45393762-45393784 CTGTGGGAGGGAAGATGAGAGGG + Intergenic
1148973543 17:51506199-51506221 CTGGGTGAGTTGAATAGAGAGGG + Intergenic
1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG + Intergenic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1152010361 17:77709363-77709385 CTGTGGGAGATGAGGAGGGAGGG + Intergenic
1152603057 17:81274807-81274829 CTGTAGGAGTTGAAACCAGAGGG - Intronic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1153640899 18:7156179-7156201 GAGTGGGTGTTGAGAGGAGATGG - Intergenic
1153894526 18:9546303-9546325 GTGTGGGATTTGAGAATAGGTGG - Intergenic
1154010339 18:10568744-10568766 CTCTGGGAGCTGAGAGAAGAGGG - Intergenic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1155094240 18:22540768-22540790 CCTTGGAAGTGGAGAAGAGAAGG - Intergenic
1155434759 18:25800918-25800940 CTAATGGAGATGAGAAGAGAAGG + Intergenic
1155584874 18:27353302-27353324 TTTGGGGAGTTGAGAATAGAAGG + Intergenic
1155705695 18:28808870-28808892 ATGTGGAAGGAGAGAAGAGAAGG - Intergenic
1156480433 18:37433063-37433085 CTGTGGGAGGTGAGCAGTGAGGG + Intronic
1156804162 18:41156328-41156350 CTGTGGGGGCCCAGAAGAGAGGG + Intergenic
1157327783 18:46681385-46681407 CAGTGGGAGATGAGAGGAGGGGG - Intronic
1157909264 18:51599754-51599776 CAGTGGAAGATGGGAAGAGATGG - Intergenic
1159629341 18:70731355-70731377 CTGTGGGAGAACAGAAGTGAGGG + Intergenic
1160002641 18:75041420-75041442 GTGTGAGAGGTAAGAAGAGACGG - Intronic
1162563541 19:11432148-11432170 CTGTGGGACTTGAGTATGGAAGG - Intronic
1163554576 19:17984775-17984797 ATCTGGGGGTTGGGAAGAGAGGG - Intronic
1164462893 19:28463954-28463976 CTGTGGCAGGTTAGAAGTGAAGG - Intergenic
1166336152 19:42108883-42108905 CTGTGAAAGCTGAGAAGGGACGG + Intronic
1166990973 19:46692537-46692559 CTGTGGGAGGTGAGTAGGAAGGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167391203 19:49196417-49196439 CTGTGGGGGAAGAGAAGAGAAGG - Intronic
1167762854 19:51460327-51460349 CTGTGATAATTGAGAAGGGAAGG + Intergenic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
925292141 2:2755109-2755131 CTGGGGGACTTTGGAAGAGAAGG + Intergenic
925330062 2:3051663-3051685 CTGGGGGAGTTGGGAAGCTAGGG - Intergenic
926166031 2:10522558-10522580 CTGTGGGAGCTGAGGAGACTGGG - Intergenic
926166046 2:10522612-10522634 CTGTGGGAGCTGAGGAGACTGGG - Intergenic
926389229 2:12370496-12370518 CTGTGGGAGGAGAGAAGAGGAGG - Intergenic
926972506 2:18480957-18480979 CTGAGGAATTTGAGAAAAGAGGG + Intergenic
927203431 2:20592373-20592395 ATGGGGGAGGTCAGAAGAGAGGG - Intronic
927496297 2:23553944-23553966 CTATGGGCTCTGAGAAGAGAGGG + Intronic
927784746 2:25965910-25965932 CTGTGGGGGTGGAAAAGACAGGG + Intronic
927927980 2:27026392-27026414 ATGTGGGAGTGGAGCAGGGAGGG - Exonic
929056337 2:37880113-37880135 GTGTGGGAGTAGAGGTGAGAAGG - Intergenic
929060062 2:37914561-37914583 CTGTGGGGCTTGTGAAGAGTTGG - Intergenic
929325004 2:40599119-40599141 ATGGGGGAACTGAGAAGAGAGGG + Intronic
929425655 2:41841972-41841994 CAGTGGCAGTTGAGAACAGCAGG + Intergenic
929480129 2:42298315-42298337 CTGTTAGAGATGAGAAGAAAGGG + Intronic
929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG + Intronic
930471202 2:51816505-51816527 CTGTGTGAATTTGGAAGAGAAGG - Intergenic
931658137 2:64528982-64529004 CTGGTAGAGTTAAGAAGAGATGG + Intronic
931973450 2:67616066-67616088 CTGTTGGAGTGAAGAAGAAAAGG - Intergenic
931987104 2:67752769-67752791 CTGTGGGAGCTGAGATGAGCTGG - Intergenic
932646166 2:73504931-73504953 AAGTGGGAGTTGAGAATATATGG - Intronic
932755809 2:74408493-74408515 TTGTGGGAGATGAAAAGAGTGGG + Intergenic
933596128 2:84285056-84285078 CCTTGGAGGTTGAGAAGAGAAGG - Intergenic
933875105 2:86612496-86612518 CTGTGGCAGTTACAAAGAGAGGG + Intronic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
936758368 2:115742235-115742257 CTGTGGGAGTTTTATAGAGAGGG - Intronic
936800301 2:116257947-116257969 CTGTGGGTGTACAGAAGACAAGG - Intergenic
937042051 2:118830140-118830162 ATGTGGGAGGAGTGAAGAGATGG - Intergenic
937278085 2:120698955-120698977 CTGTAGAAAGTGAGAAGAGAGGG - Intergenic
937835754 2:126468939-126468961 CTGTGTGTCCTGAGAAGAGAGGG - Intergenic
939676930 2:145084230-145084252 ATGTGGGATATGGGAAGAGATGG + Intergenic
939866677 2:147480904-147480926 CTGTGGGAGTTCACAAGAGAGGG + Intergenic
941767384 2:169313196-169313218 CTTTGAGAGTTGAGAGAAGAAGG - Intronic
943482553 2:188439197-188439219 CTGTTGGAGTTGGAAAGGGATGG + Intronic
943792281 2:191946864-191946886 CTCTGGGTTTTGTGAAGAGAAGG + Intergenic
944440462 2:199738042-199738064 TTGGGGGAGTTGATAAGAAACGG + Intergenic
944500962 2:200359887-200359909 CTGTAGAAGTTCAGAAGAGAAGG - Intronic
945020475 2:205566127-205566149 CTGTGGGAGTTGAGCAGGAAAGG + Intronic
945035788 2:205702927-205702949 CTCTGGGAGTTCAGAGGAAAGGG - Intronic
945608194 2:211963281-211963303 GTGTGGGAGGTGGGAAGAAAGGG - Intronic
945874177 2:215260574-215260596 ATGTGGGAGTGAAGAAGAAAAGG + Intergenic
946343368 2:219087069-219087091 GAGTGGGAGTAGAGAAAAGAAGG - Intronic
946889332 2:224259214-224259236 CTGGGGGAATTCTGAAGAGAGGG + Intergenic
947861127 2:233358559-233358581 TTGAGGGAGTTGAGAGGAAACGG - Intronic
948379443 2:237542363-237542385 CTGTGGTTGTTGAGAAGGGGGGG - Intronic
948870255 2:240794201-240794223 CTGAGGGAGCTCAGGAGAGAAGG - Intronic
1169084327 20:2817208-2817230 CTGGGGGCTTTGAGAAGAGGGGG + Intronic
1169961877 20:11169146-11169168 CTGTGAATGTTGAGAAGATATGG + Intergenic
1172043381 20:32061896-32061918 GGGTGGGGGTTGAGCAGAGAAGG + Intronic
1172046842 20:32086504-32086526 CTCTGAGAGTTGAGATGAGCAGG + Intronic
1172196065 20:33092435-33092457 CTGGGGGAGAAGAGAAGAAAGGG - Intronic
1172842944 20:37912969-37912991 GTGGGGGCGGTGAGAAGAGAGGG - Intronic
1172937363 20:38629710-38629732 GTGTGGAAGGTGTGAAGAGATGG - Intronic
1172952936 20:38733616-38733638 CTCAGGGAGATGAGGAGAGATGG - Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173367704 20:42402146-42402168 GTGTGGGAGATGGGGAGAGAAGG + Intronic
1173963482 20:47093089-47093111 CTGTGGCAAATGGGAAGAGAAGG - Intronic
1174136237 20:48382031-48382053 CTGTCTGGGTGGAGAAGAGACGG + Intergenic
1174253502 20:49236735-49236757 AGGTGGAAATTGAGAAGAGAAGG + Intronic
1175078152 20:56393081-56393103 CTGTGGGAGTTGAGAAGTTAGGG + Intronic
1175690557 20:61062878-61062900 CAGGTGGCGTTGAGAAGAGATGG + Intergenic
1176162387 20:63654292-63654314 CTTTGGGAGTTATGAGGAGAGGG - Intergenic
1177269893 21:18833951-18833973 AAGTGGGAGTTGAGAATACATGG - Intergenic
1179403890 21:41109595-41109617 CTGTGGCAGTGGGGAAGTGAAGG + Intergenic
1179442947 21:41408346-41408368 CTGAGGGAGTACAGTAGAGATGG - Exonic
1179631656 21:42682625-42682647 GTGGGGGCCTTGAGAAGAGAGGG - Intronic
1180662051 22:17476209-17476231 CTATGGGAGCTGAGAAGAAAAGG - Intronic
1182012263 22:27010825-27010847 GTGAGGAAGTTGAGAGGAGATGG - Intergenic
1182645434 22:31805162-31805184 CTGTGGGAGTTGGGAATAGAAGG - Intronic
1182821530 22:33220952-33220974 CTGTGGGAGTGAGAAAGAGAGGG - Intronic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1184134966 22:42542738-42542760 GTGGGGGAGGTGAGGAGAGACGG + Intergenic
1184212580 22:43044632-43044654 GAGTGGGCGTGGAGAAGAGAGGG - Intronic
1184559743 22:45255278-45255300 CTGTGGGAGTGAAGAAGGGGAGG + Intergenic
1185139186 22:49090766-49090788 CAGTGGGAGCTGCAAAGAGAGGG - Intergenic
1185175858 22:49326184-49326206 CGCTGGCAGTTGAGGAGAGAAGG - Intergenic
949202718 3:1398785-1398807 CTCTGGGAGATGAGAAGAGTTGG - Intronic
950037812 3:9899698-9899720 CTGTGAGAGATCAGAAGATAAGG + Intergenic
951532702 3:23712651-23712673 CTGTGTGAGTCGAGGAGAGATGG + Intergenic
951532746 3:23713037-23713059 CTGTGGGGGTTGGGGAGAGAAGG - Intergenic
952074398 3:29678228-29678250 TGGTGGGAGATAAGAAGAGAAGG + Intronic
952154471 3:30627893-30627915 CTTTGGGACTTGAGAAGAATGGG - Intronic
953118184 3:40013435-40013457 CTGTGCTGGTTCAGAAGAGAAGG + Intronic
953330381 3:42048059-42048081 CTCTTGGAGTGGAGGAGAGAGGG - Intronic
953885548 3:46712692-46712714 CTGTTGGAGGTGAGAGGAGTGGG - Intronic
954744270 3:52778159-52778181 CTGTGGGATATGAGGTGAGATGG - Intronic
955153908 3:56396900-56396922 CTGTGGGAGATGAGAAAAGTGGG - Intronic
956853061 3:73248991-73249013 CTGGGAGAGGTGGGAAGAGAGGG + Intergenic
956860429 3:73318222-73318244 TTGTGTGATTTGAGAAAAGAAGG - Intergenic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
960423869 3:117482358-117482380 CTGTGGGACTTGAGAGGAAGAGG + Intergenic
960481095 3:118191019-118191041 CTGTGGGAATTGAGAATCCATGG - Intergenic
960615080 3:119589143-119589165 CTGTGGGAGGAGTGAGGAGAAGG - Exonic
960995975 3:123340542-123340564 CTGTGGGAGATAAGAAGGGAGGG - Intronic
961718861 3:128878914-128878936 CAGAGAGAGCTGAGAAGAGATGG - Intergenic
961800152 3:129441291-129441313 CCGTGTGAGATGAGGAGAGACGG - Intronic
962844464 3:139262570-139262592 CTGCTGGAGATGAAAAGAGAGGG - Intronic
963560121 3:146854571-146854593 CTCTGGGATTTCAGAAGAGCAGG - Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964336207 3:155657351-155657373 CTCTGTCAGTTGAGAAGACAAGG + Intronic
965829698 3:172771541-172771563 CAGTGACAGTTGAGATGAGATGG + Intronic
965869902 3:173252897-173252919 CTGGTGGAGTTGTGAAAAGAGGG - Intergenic
966247641 3:177826415-177826437 CTTTGGGAAGTGAGAAGGGAAGG + Intergenic
966614534 3:181899097-181899119 ATGTGGTAGGAGAGAAGAGAAGG - Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
969176645 4:5403818-5403840 CTGTAGCAGTTGAGAAGGAAGGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969457124 4:7306506-7306528 CAGAGGGAGTTCAGAACAGAGGG + Intronic
970254735 4:14155567-14155589 CAGTGGGCGTTGAGAGGAGGTGG + Intergenic
970573683 4:17407003-17407025 CTTGGGGAGGTGGGAAGAGAGGG - Intergenic
970959855 4:21858974-21858996 GTGTGGGAGTAAAGAAGAGATGG + Intronic
971452004 4:26809324-26809346 CTGAGGGACTGGACAAGAGAGGG + Intergenic
971762753 4:30789350-30789372 CTGATTGAGTTCAGAAGAGAAGG + Intronic
971808517 4:31393205-31393227 TTGTTTGAGTTGAGAAGGGATGG + Intergenic
972299856 4:37774316-37774338 CTGTGGGAGGTGAGTAGTCAAGG + Intergenic
972709166 4:41577072-41577094 CTGTGGGACTTGAGTACACATGG + Intronic
972876933 4:43374153-43374175 ATTTGTGAGTTGATAAGAGATGG + Intergenic
972909273 4:43794627-43794649 CTCTGGGAACAGAGAAGAGAGGG - Intergenic
973302810 4:48607616-48607638 GAGTGGGAGTGGGGAAGAGAAGG - Intronic
973779305 4:54273158-54273180 GTGTGAGTGTTGAGAAGGGAGGG + Intronic
974134947 4:57803784-57803806 CTTTGGGAGCTGAGACGGGAAGG - Intergenic
974791349 4:66694091-66694113 TTGTGGGAGTTGGTTAGAGAAGG - Intergenic
976075044 4:81288370-81288392 CTGTGGGAGGGGTGAAGGGAAGG - Intergenic
976291809 4:83426432-83426454 CTCAGGAAGTTGAGAAGAGATGG + Intronic
976784515 4:88802813-88802835 CTACTGGAGTGGAGAAGAGATGG - Intronic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
977282569 4:95060180-95060202 ATTTGGGAGTTGAGCTGAGAAGG + Intronic
977687588 4:99866274-99866296 TTCTGGGACATGAGAAGAGATGG + Intronic
978037671 4:104015779-104015801 CTGAGGGAGTTGATTAGAAAAGG - Intergenic
980480801 4:133385183-133385205 CGGTGGGAGTTGGGAATAGGAGG + Intergenic
981657961 4:147133473-147133495 CTACAGGAGTTGAGAAGAAAGGG - Intergenic
981730531 4:147892552-147892574 CTGTGGGAGTTGAGCAGCATGGG + Intronic
982338705 4:154270640-154270662 CTGTGAGAACAGAGAAGAGAGGG + Intronic
983182195 4:164661483-164661505 CTGTGTGATATGAGAAGAAATGG + Intergenic
984250105 4:177321541-177321563 CTGTGGGAGAAGAAAAGAAAGGG - Intronic
984885809 4:184448413-184448435 CTGGGGGAGATGAGGAGTGATGG + Intronic
986790573 5:11155596-11155618 CTGTGGGTGATCAGAAGGGAAGG - Intronic
987021543 5:13877905-13877927 CTGTGGAAGTTGTGCAGAGACGG + Intronic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
989136072 5:38156307-38156329 CTCTAGAAGTTGAGAATAGAAGG - Intergenic
989398394 5:40982787-40982809 CTGTGGGAGGAGAAATGAGAGGG + Exonic
990516731 5:56537233-56537255 CAGTGGGAGATGAGAAGGGGAGG + Intronic
990763709 5:59159234-59159256 CTGGGGGAGTTGAGATAGGAGGG - Intronic
990957581 5:61359153-61359175 CAGTGGGAGTGGATCAGAGAGGG + Intronic
991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG + Intergenic
991452617 5:66768988-66769010 ATATGGGAATTGAGAAGAGAAGG + Intronic
992005442 5:72472926-72472948 CTGTGGGAGTTGAGAGGAAGGGG - Intronic
995163353 5:109008574-109008596 CTAGGGAAGGTGAGAAGAGAAGG - Intronic
995730419 5:115234366-115234388 GTATGGGAGTTAAGAAGAGGGGG + Intronic
995803102 5:116021057-116021079 CTGTTGAAGTTGACAAGAGCAGG + Intronic
995835674 5:116397218-116397240 CTGTGGGAGCTGAGCAAAGTGGG - Intronic
996790094 5:127283047-127283069 CTGAGGGATTCCAGAAGAGAGGG - Intergenic
997338083 5:133121846-133121868 CCCTGGGAGATGAGTAGAGAGGG + Intergenic
997379771 5:133427300-133427322 CTGTGGGAGCTGATAAAACAAGG - Intronic
997389343 5:133501091-133501113 CTGGGGAAGATGAAAAGAGAGGG + Intronic
997852186 5:137343112-137343134 CTGTGGGAGTGGATAAGTGTCGG - Intronic
997942314 5:138169183-138169205 CTGTGGGAATTGATCAGTGAAGG - Intronic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998586269 5:143431037-143431059 ATGTGGGAGGAGAGAGGAGAAGG + Intronic
999059980 5:148623373-148623395 CTGTGGGAAGAGACAAGAGATGG + Intronic
999268163 5:150280530-150280552 GTGTGGGAGGTGGGAAGAGGAGG - Intronic
999793288 5:154963778-154963800 TTGTTGGAGTAGAGAAGAAAAGG + Intronic
1000168849 5:158681817-158681839 CTTTAGGAGTAGAGAAGAGCAGG - Intergenic
1000942829 5:167383430-167383452 CTGTGGGACTTGAGAAAACATGG - Intronic
1001456770 5:171868177-171868199 TTGTGGTAGTGGGGAAGAGAGGG + Intronic
1001711804 5:173784773-173784795 CTGTGGGAGATGAGTAGAGATGG + Intergenic
1001946498 5:175782879-175782901 CAGTAGGAGCTGAGAAGGGAGGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003426718 6:6002812-6002834 ATGAGGGAGGTGAGAAGAGGGGG - Intronic
1005183171 6:23130580-23130602 CTTTGGGAATGCAGAAGAGAAGG + Intergenic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1005679361 6:28190483-28190505 GTCATGGAGTTGAGAAGAGATGG + Intergenic
1006308572 6:33240682-33240704 CTGGGGGAGTTGAGGAGAAAAGG + Intergenic
1006393778 6:33773794-33773816 CTGAGGGAGATGAGAAGAACTGG - Intronic
1006563562 6:34934808-34934830 GGGTGGGAGGTGAAAAGAGAGGG - Intronic
1006733286 6:36252654-36252676 CTGTCGGAGTTGTGAAAGGAGGG + Intronic
1006915271 6:37589870-37589892 CTGTGGGGGGTGGGAAGAGAAGG - Intergenic
1007316261 6:40991815-40991837 CTGTGTGACTTGAGAAGAAGGGG - Intergenic
1007371954 6:41431953-41431975 CTGGGAGAGGTGAGAGGAGATGG + Intergenic
1008096671 6:47346104-47346126 CTGTGAGACTAAAGAAGAGAAGG - Intergenic
1008422532 6:51318630-51318652 GAGTGGGAGGTGAGAAGGGAGGG - Intergenic
1009439544 6:63660935-63660957 CTGTGGAACTTGAGGAGACAGGG + Intronic
1009572966 6:65413029-65413051 CTGGGGAAATTGAGAAGTGATGG - Intronic
1009900526 6:69803255-69803277 CTGTGGAAGCTGCGGAGAGATGG + Intergenic
1010139339 6:72596138-72596160 TGTTGAGAGTTGAGAAGAGAGGG + Intergenic
1010705670 6:79106444-79106466 ATGTGGGAGCAGAAAAGAGAAGG + Intergenic
1012047773 6:94300760-94300782 CTGTGCGTGAGGAGAAGAGAGGG + Intergenic
1013014143 6:106145819-106145841 AGGTGGGAGATGAGGAGAGAAGG + Intergenic
1013653302 6:112218761-112218783 ATGTGGGAGATGGGAAGAAAAGG + Intronic
1013659314 6:112278627-112278649 GAGTGGGAGTTGAGATGAGGAGG + Intergenic
1014207651 6:118673594-118673616 CTGTGGGAGTAGGGCAGAGGTGG - Intronic
1016527839 6:145022692-145022714 GAGTGGGAGTTGAAAAGAGTAGG + Intergenic
1016792604 6:148081085-148081107 CTGAGGGAGTTGGGCAGAGTTGG + Intergenic
1018598671 6:165514507-165514529 CACTGGGAGCTGTGAAGAGATGG + Intronic
1019231881 6:170573097-170573119 CTGTTGGAGGTGAGGAGATAAGG + Intergenic
1019598947 7:1871901-1871923 GTGGAGGAGATGAGAAGAGAGGG + Intronic
1019729537 7:2622636-2622658 CAGTAGGAGTTGAGAGGAGGAGG - Intergenic
1020068889 7:5212458-5212480 CTGCCGGATTTGAGAAGTGAGGG + Intronic
1021508203 7:21408090-21408112 CTGTGGGATTTGAAGAAAGAAGG + Intergenic
1021799550 7:24290542-24290564 CTGAGGGAGGTTAGAAGGGAAGG - Intronic
1021988445 7:26119647-26119669 CTGAGGGAGGTGAGGAGAAATGG + Intergenic
1022476810 7:30716386-30716408 CTGTGGGGGCTGAGCAGAGCTGG + Intronic
1022530130 7:31061744-31061766 CTGTGGGAGGCAAGGAGAGAGGG + Intronic
1022831144 7:34067937-34067959 CTGTGGGAATTGACAATAGGTGG - Intronic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1024149336 7:46553998-46554020 CAGAGGAAGTTGAGAAAAGAGGG + Intergenic
1024645645 7:51368381-51368403 CTGTGGGAGCAGAGAATAAAGGG - Intergenic
1024754406 7:52512733-52512755 CTGTGGGTGATGTGATGAGAGGG - Intergenic
1025940400 7:66072739-66072761 CTGTGGGAGAAGACAGGAGAGGG + Intergenic
1026111171 7:67459957-67459979 TTGTGTGATTTGAGTAGAGATGG + Intergenic
1027592114 7:80130737-80130759 CTGTGGGACTGGAGAATTGATGG + Intergenic
1027955364 7:84872395-84872417 CCATGGCAGTTTAGAAGAGATGG + Intergenic
1028253333 7:88561294-88561316 CTTTAGGAGTTGAAAATAGAAGG - Intergenic
1029434722 7:100556567-100556589 CAGTGAGGGTGGAGAAGAGAAGG - Intronic
1029610092 7:101622201-101622223 CTGTGGGAGGTGAGAGGTGGGGG + Intronic
1029712896 7:102309185-102309207 CACTGGGAGTTGGGCAGAGATGG + Intronic
1030414700 7:109227996-109228018 CAGTGGGAGGTGAGAAGAAGAGG + Intergenic
1030687317 7:112500197-112500219 CTGAGGCAATAGAGAAGAGAAGG - Intergenic
1030759218 7:113330721-113330743 CTGTGGAAATTGAAAAGAAATGG + Intergenic
1030787970 7:113685482-113685504 CTCTGGGAGCTGAGAAAGGAGGG - Intergenic
1030889784 7:114985405-114985427 TTTAGGGAGTTGAGAATAGAGGG + Intronic
1032424076 7:131806494-131806516 CAGTAGGAGTTGGGGAGAGAGGG + Intergenic
1032655975 7:133929858-133929880 CTCTTGGAATAGAGAAGAGAAGG - Intronic
1033440235 7:141371857-141371879 CTTTAGTAGTTAAGAAGAGATGG - Intronic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035400716 7:158563704-158563726 ATGTGTGAGGGGAGAAGAGAGGG + Intronic
1035754906 8:2023804-2023826 CTGGGGGCTTTGAGAAGCGACGG + Intergenic
1037425182 8:18747899-18747921 CGGTGGAAGGTGGGAAGAGAAGG + Intronic
1038258576 8:25972944-25972966 GGGTGGGAGTTGGGGAGAGAGGG - Intronic
1038778889 8:30554326-30554348 CTGTGGGTGTTGAGAAATGCTGG - Intronic
1038781951 8:30575625-30575647 CTGTGGGAGTTGTGGTGGGATGG - Intergenic
1038967924 8:32596231-32596253 CTGTAGGAAGTAAGAAGAGATGG + Intronic
1039417188 8:37405802-37405824 CTATGGGTGTTGAAAAGACAAGG - Intergenic
1039627527 8:39069267-39069289 CTGTGGGATTTTAGGAGGGAGGG + Intronic
1041538247 8:58952820-58952842 CTGTGGGATTTGTGAATATAAGG - Intronic
1041693046 8:60708418-60708440 CTGCAGGAGTCCAGAAGAGAAGG - Intronic
1042294353 8:67203503-67203525 CCATAGCAGTTGAGAAGAGAAGG - Intronic
1044110650 8:88268792-88268814 GTGTGGGATTTGTGAAGAAATGG - Intronic
1044169758 8:89034770-89034792 CTGTGACATTTGAGAAGAGCAGG + Intergenic
1044503728 8:92992234-92992256 CTGGGGGAGTGGAGGAGAAATGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045075572 8:98563064-98563086 CTGAAGGAGGTGAGAAGAAAAGG + Intronic
1047632251 8:126721183-126721205 CAGTTGAATTTGAGAAGAGAAGG + Intergenic
1047902006 8:129432643-129432665 CTTTGGTAGTTGAGAAAAAATGG - Intergenic
1048082320 8:131142010-131142032 ATGTGGGAGGAGGGAAGAGAAGG + Intergenic
1049133609 8:140872648-140872670 CTGTGGGGATTGGGAAGAGCTGG + Intronic
1049578711 8:143401172-143401194 CTGTGGGAGGTGGGAAAAGGGGG + Intergenic
1052836370 9:33252996-33253018 ATGAGGGGGTTGAGATGAGATGG + Exonic
1055390260 9:75813630-75813652 AAGTGGGAGTAGAGAATAGAGGG + Intergenic
1055474345 9:76646668-76646690 CTGGGGGAGTAGAGACCAGATGG - Intronic
1056148936 9:83765251-83765273 CTGTGGGTGCACAGAAGAGAAGG + Intronic
1057519292 9:95748483-95748505 CTGAGGGAGGTGAGCAGCGATGG - Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058205410 9:102100016-102100038 CTGTGGCAGTTGGCAACAGAGGG + Intergenic
1058211324 9:102173675-102173697 CTTTGCGAGTTGAGAGAAGAAGG - Intergenic
1058471585 9:105284931-105284953 AAGTGGGAGTTGAGAGGAAATGG - Intronic
1058762384 9:108147601-108147623 GGGTGGGAGTCAAGAAGAGATGG + Intergenic
1059057909 9:111003757-111003779 TTGTGGGAGTTAAGGGGAGATGG + Intronic
1059553275 9:115251736-115251758 CAGTGGGAGAAGTGAAGAGATGG - Intronic
1059830674 9:118091945-118091967 CTGTGAGAGATGAGAACACAGGG - Intergenic
1060189389 9:121582416-121582438 CTGTGGGGGGTGAGAAGGAAGGG + Intronic
1060865672 9:126994186-126994208 CTTTGAGAGTTGAGAGAAGAAGG + Intronic
1061823263 9:133240217-133240239 CTGTGTGTGTTTAGTAGAGACGG - Intergenic
1061960444 9:133985998-133986020 CTGAGAGAGATGAGCAGAGAAGG + Intronic
1062280579 9:135749974-135749996 CTGCAGGAGTTGAGAAGTCAGGG - Intronic
1186695924 X:12031892-12031914 CAGTGGGAGGTGACAAGATATGG + Intergenic
1187734701 X:22291960-22291982 TTGTGGGTTTTGAGCAGAGAAGG - Intergenic
1189474131 X:41335467-41335489 ATGTGTGATTTGAGAGGAGAAGG + Intronic
1190031700 X:46979400-46979422 CTCAGGGAGGTGAGGAGAGAGGG + Intronic
1191870023 X:65737988-65738010 CTGTTGGAGGTGGGAATAGAGGG + Intronic
1191895730 X:65990758-65990780 CAGTGGGGGCTGAGGAGAGAGGG + Intergenic
1192917305 X:75666337-75666359 CTCTGGGGGTGGAGCAGAGAGGG + Intergenic
1193730530 X:85097205-85097227 CTGTGGGACTTGAGTAGGCATGG + Intronic
1194720083 X:97330015-97330037 CTGTGCAAGTTCAGGAGAGAGGG - Intronic
1195836392 X:109119401-109119423 CTGAGGGTGTTGAGATGTGATGG - Intergenic
1196370319 X:114971065-114971087 CTGAGGAAGTTGAAAAGAGTTGG + Intergenic
1196515658 X:116606968-116606990 CTGTGGGAGGTGAGATTAGGGGG + Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197412804 X:126139444-126139466 TTCTTGGAGTGGAGAAGAGAGGG + Intergenic
1197556787 X:127965072-127965094 CTGTTGGATTTGGGAAGGGATGG - Intergenic
1197585494 X:128342390-128342412 CTGAGGCAGTGGATAAGAGATGG + Intergenic
1197705111 X:129629349-129629371 CTGTGGGACTTGAGTATACATGG + Intergenic
1197802224 X:130363188-130363210 CTGGGGGAAATGAGAAGTGATGG - Intronic
1197968626 X:132092171-132092193 CTGAGGGAGTTCATAAAAGAGGG + Intronic
1198086645 X:133288579-133288601 CTGTGGGAGTTGAATTGAGCTGG + Intergenic
1198440752 X:136660821-136660843 CTGTTGGAGGTGACAAGAAATGG - Intergenic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200822341 Y:7599788-7599810 CTCTGGGATTTCAGAAGAGCAGG + Intergenic
1202104353 Y:21347049-21347071 CTCTGGGATTTCAGAAGAGTGGG + Intergenic
1202237960 Y:22734229-22734251 CTCTGGGATTTCAGAAGAGCAGG - Intergenic