ID: 1199610601

View in Genome Browser
Species Human (GRCh38)
Location X:149609703-149609725
Sequence GGAACATGGTTGGGTCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199610601 Original CRISPR GGAACATGGTTGGGTCCTAC AGG (reversed) Intronic
900310271 1:2030077-2030099 GGAACCTGATGGGCTCCTACAGG + Exonic
902189502 1:14752182-14752204 GGAAGATGTTTGGGTCATAGGGG - Intronic
904979389 1:34484196-34484218 GGAACATGGCTCTGTCTTACTGG - Intergenic
910954011 1:92681896-92681918 GAAACATGGTAGGGTGCTAGGGG - Intronic
911818011 1:102379117-102379139 GGAACACGGTTGGATTCCACTGG - Intergenic
920194931 1:204220457-204220479 GGCACAGGGTTGGGACCTAAAGG + Exonic
922542879 1:226432627-226432649 GGATCATGGTGGGGGCCTAGAGG + Intergenic
1064203224 10:13301389-13301411 GGAACATGACTGGGGGCTACAGG - Intronic
1066534020 10:36370727-36370749 GGAACATGGTGGGGCGCTGCTGG - Intergenic
1066980138 10:42405390-42405412 GGCACATTGTTGGGCCCAACTGG + Intergenic
1067494566 10:46750232-46750254 GGAACATGGGTGTATCCTTCAGG + Intergenic
1067600091 10:47590165-47590187 GGAACATGGGTGTATCCTGCAGG - Intergenic
1071651632 10:87398046-87398068 GGAACATGGGTGTATCCTGCAGG - Intergenic
1071724417 10:88182275-88182297 GGAACATGGTTAGGTACATCCGG - Intergenic
1071978326 10:90977561-90977583 GGGACATGTTTGGGTCCTGGTGG + Intergenic
1075411681 10:122233203-122233225 GGAATTTGGTTGTGTCCTCCTGG + Intronic
1079636637 11:22750287-22750309 GGAAAATGGTTGGACACTACAGG + Intronic
1088565210 11:111165000-111165022 GAAAAAGGGTTGGGTCCTACAGG - Intergenic
1092987182 12:13856913-13856935 AGAACATGGGTGGGTCATATAGG - Intronic
1093173400 12:15883585-15883607 GGAACATTTTTGGGTCATAAAGG + Exonic
1103928235 12:124435521-124435543 CGAACTTGGTTGGGTACTAGAGG - Intronic
1106144608 13:27039966-27039988 GGAACATGGCTGGGACCCCCGGG - Intergenic
1115731046 14:36270488-36270510 AGAAAATGGGTGGGTACTACGGG - Intergenic
1117657061 14:57965991-57966013 GAAACATTGCTGGGTCCTACTGG - Intronic
1122968861 14:105144334-105144356 GGGACATGGATGGGTGCTGCTGG - Intronic
1126112444 15:45183652-45183674 GGACCATGGGTGGGAGCTACTGG - Intronic
1127308483 15:57730466-57730488 GGAACCTGGTTGGCTCCTTCTGG - Intronic
1128624862 15:69189986-69190008 GGAAATTAGTTGGGGCCTACTGG - Intronic
1129688813 15:77701570-77701592 GGAAGATGTTTGGGTCATAGGGG + Intronic
1130415789 15:83693488-83693510 GGAACCTGGCTGGGACCTGCAGG - Intronic
1130541940 15:84826756-84826778 GAAACATGGTTGGCTGCTCCAGG - Intronic
1132250814 15:100334476-100334498 GGAAGCTGGTTGGTCCCTACAGG - Intronic
1133736212 16:8617750-8617772 GCAGCATGGCTGGGTCCTTCTGG + Intergenic
1133855579 16:9546446-9546468 GGGACATGGGTGTGTCCTACAGG + Intergenic
1142537378 17:628206-628228 AGAACATTGCTGGGTCCTCCTGG + Exonic
1143556953 17:7667982-7668004 GGAACAGGGGTGGGTGCTACTGG - Intronic
1144437913 17:15257946-15257968 GGGACATGCTTGGGTATTACTGG + Intronic
1161634711 19:5380506-5380528 GGAATATGGGTGGGTGCTAAGGG - Intergenic
1162393092 19:10401459-10401481 GGAGAATGGTTTGGTCCTGCCGG - Intronic
1162592931 19:11604863-11604885 GGAACTTGGTTGGGTCTCATAGG + Intronic
1163740190 19:19007066-19007088 GGAAGATGGGTGCCTCCTACCGG + Intronic
1164314145 19:24071968-24071990 GAAATATGGCTGGGTCCAACAGG + Intronic
925834869 2:7934748-7934770 GGAACTTGGTTGGGTGCAATAGG + Intergenic
928349149 2:30531310-30531332 GGATCATGGCAGAGTCCTACAGG - Intronic
928477827 2:31649072-31649094 GAAACATGGTTGGGTTCTAGAGG - Intergenic
935474957 2:103507708-103507730 AGAACATGGTTGGGTCTTGGTGG + Intergenic
941506136 2:166348020-166348042 GGAAAAAGGTTTGGTCCTTCTGG - Intronic
946032027 2:216712994-216713016 GGAACATTGTTGGATGCTACAGG - Intergenic
946355164 2:219179938-219179960 GGCAGAGGGTTGGGTCCTCCTGG + Intronic
1168832952 20:857137-857159 GGAACATGGTGGGATGATACAGG - Intronic
1172842471 20:37910074-37910096 GCAACAAGATTGGGTCCTACCGG + Intronic
1175749646 20:61486394-61486416 GGAACAGGGTAGGGCCCCACGGG - Intronic
1180244641 21:46538979-46539001 GGAGAATGGTTGGGTCCTGGTGG - Intronic
1182085577 22:27558869-27558891 GAACCATGATTGGGTCCCACTGG - Intergenic
1182704822 22:32270537-32270559 GGAATATGGTTGAGTCTTCCTGG - Intergenic
964658473 3:159094044-159094066 GGAACAGGGTTTGGGCCTCCTGG + Intronic
969225840 4:5797744-5797766 GGTACATGGGTGGCCCCTACGGG - Intronic
983088115 4:163472411-163472433 GGAACATGGCTAGATCCTCCAGG + Exonic
989241022 5:39202797-39202819 GGTACATTGCTGGGTCCTGCAGG + Exonic
994305056 5:98192955-98192977 GGAACATGATTGGCTCATAGGGG - Intergenic
1001941609 5:175743645-175743667 GGACTGTGGTTGGGTCATACAGG + Intergenic
1016239746 6:141916400-141916422 GGAACATGGTTTGGCAGTACTGG + Intergenic
1017404390 6:154102634-154102656 GGGAGATGGGTGGGTGCTACTGG - Intronic
1030868370 7:114727316-114727338 GGAACATGGATGGGAGCTAGAGG - Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1033311317 7:140264094-140264116 AGAACATTGCTGGGTCCCACAGG + Intergenic
1035325247 7:158061729-158061751 GGATCATTGTTAGGTCCTTCAGG - Intronic
1036119400 8:5999438-5999460 GGAACATGATTAGGTCATAATGG + Intergenic
1036628881 8:10496529-10496551 GGAAAATGGGAGGGTCCTAGTGG + Intergenic
1037433794 8:18842047-18842069 GGAAGATGGTGAGGTCTTACTGG - Intronic
1048691230 8:136966289-136966311 GGAACATGTTTTAGTCCCACAGG + Intergenic
1050361636 9:4836279-4836301 GCAAGGTGGGTGGGTCCTACAGG + Intronic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1059248175 9:112865989-112866011 AGACCAGGGTTGGGTCCTCCTGG - Intronic
1061191612 9:129085680-129085702 GGTCCATGGTGGGGTCCGACAGG - Intronic
1061280280 9:129594152-129594174 GGAAGCTGGATGGGTCCTACCGG - Intergenic
1199610601 X:149609703-149609725 GGAACATGGTTGGGTCCTACAGG - Intronic
1202129956 Y:21600549-21600571 TCTCCATGGTTGGGTCCTACTGG + Intergenic