ID: 1199612606 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:149631283-149631305 |
| Sequence | GCAGGACGGGGCTCGCGGCC GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199612591_1199612606 | 20 | Left | 1199612591 | X:149631240-149631262 | CCAATGAGGGACAGCAAGCAGAA | No data | ||
| Right | 1199612606 | X:149631283-149631305 | GCAGGACGGGGCTCGCGGCCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199612606 | Original CRISPR | GCAGGACGGGGCTCGCGGCC GGG | Intronic | ||