ID: 1199612606

View in Genome Browser
Species Human (GRCh38)
Location X:149631283-149631305
Sequence GCAGGACGGGGCTCGCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199612591_1199612606 20 Left 1199612591 X:149631240-149631262 CCAATGAGGGACAGCAAGCAGAA No data
Right 1199612606 X:149631283-149631305 GCAGGACGGGGCTCGCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199612606 Original CRISPR GCAGGACGGGGCTCGCGGCC GGG Intronic