ID: 1199613879

View in Genome Browser
Species Human (GRCh38)
Location X:149639946-149639968
Sequence CTGCAGTCCTTAGGAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199613871_1199613879 27 Left 1199613871 X:149639896-149639918 CCTCCAGGGGAGGCTGTGGGGGT No data
Right 1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG No data
1199613872_1199613879 24 Left 1199613872 X:149639899-149639921 CCAGGGGAGGCTGTGGGGGTGTG No data
Right 1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG No data
1199613874_1199613879 -7 Left 1199613874 X:149639930-149639952 CCTAGCTGCTCCAGCCCTGCAGT No data
Right 1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199613879 Original CRISPR CTGCAGTCCTTAGGAAACAC AGG Intergenic
No off target data available for this crispr