ID: 1199616608

View in Genome Browser
Species Human (GRCh38)
Location X:149660763-149660785
Sequence TGATCCTCGGGTGCTCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199616601_1199616608 -8 Left 1199616601 X:149660748-149660770 CCTTAAGGCTTCCCCTGATCCTC No data
Right 1199616608 X:149660763-149660785 TGATCCTCGGGTGCTCCAGAGGG No data
1199616600_1199616608 -2 Left 1199616600 X:149660742-149660764 CCTCGTCCTTAAGGCTTCCCCTG No data
Right 1199616608 X:149660763-149660785 TGATCCTCGGGTGCTCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199616608 Original CRISPR TGATCCTCGGGTGCTCCAGA GGG Intergenic
No off target data available for this crispr