ID: 1199618641

View in Genome Browser
Species Human (GRCh38)
Location X:149679546-149679568
Sequence AAGAGGATTAATAGGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199618641_1199618649 24 Left 1199618641 X:149679546-149679568 CCATCTGTCCTATTAATCCTCTT No data
Right 1199618649 X:149679593-149679615 AACAACTGAACTGAATATCATGG No data
1199618641_1199618646 -7 Left 1199618641 X:149679546-149679568 CCATCTGTCCTATTAATCCTCTT No data
Right 1199618646 X:149679562-149679584 TCCTCTTGGGGAATGTTTAGTGG No data
1199618641_1199618648 -6 Left 1199618641 X:149679546-149679568 CCATCTGTCCTATTAATCCTCTT No data
Right 1199618648 X:149679563-149679585 CCTCTTGGGGAATGTTTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199618641 Original CRISPR AAGAGGATTAATAGGACAGA TGG (reversed) Intergenic
No off target data available for this crispr