ID: 1199618949

View in Genome Browser
Species Human (GRCh38)
Location X:149682141-149682163
Sequence CAAGCTTCTCTCATTCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199618944_1199618949 18 Left 1199618944 X:149682100-149682122 CCTCCAGGAGCATCAGCGAATTC No data
Right 1199618949 X:149682141-149682163 CAAGCTTCTCTCATTCATCTGGG No data
1199618947_1199618949 -8 Left 1199618947 X:149682126-149682148 CCGTGAAGGTCTGAGCAAGCTTC No data
Right 1199618949 X:149682141-149682163 CAAGCTTCTCTCATTCATCTGGG No data
1199618945_1199618949 15 Left 1199618945 X:149682103-149682125 CCAGGAGCATCAGCGAATTCTCA No data
Right 1199618949 X:149682141-149682163 CAAGCTTCTCTCATTCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199618949 Original CRISPR CAAGCTTCTCTCATTCATCT GGG Intergenic
No off target data available for this crispr