ID: 1199621284

View in Genome Browser
Species Human (GRCh38)
Location X:149704059-149704081
Sequence AGTTAGCAGTGGAAGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 539}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199621284_1199621295 29 Left 1199621284 X:149704059-149704081 CCAGCCATCTTCCACTGCTAACT 0: 1
1: 0
2: 2
3: 30
4: 539
Right 1199621295 X:149704111-149704133 ATCTTAAAGGAGCCAAGTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 149
1199621284_1199621294 26 Left 1199621284 X:149704059-149704081 CCAGCCATCTTCCACTGCTAACT 0: 1
1: 0
2: 2
3: 30
4: 539
Right 1199621294 X:149704108-149704130 CTGATCTTAAAGGAGCCAAGTGG 0: 1
1: 0
2: 1
3: 12
4: 120
1199621284_1199621287 2 Left 1199621284 X:149704059-149704081 CCAGCCATCTTCCACTGCTAACT 0: 1
1: 0
2: 2
3: 30
4: 539
Right 1199621287 X:149704084-149704106 TGCCCTATCAATATGCCCCTAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1199621284_1199621290 16 Left 1199621284 X:149704059-149704081 CCAGCCATCTTCCACTGCTAACT 0: 1
1: 0
2: 2
3: 30
4: 539
Right 1199621290 X:149704098-149704120 GCCCCTAGGACTGATCTTAAAGG 0: 1
1: 0
2: 1
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199621284 Original CRISPR AGTTAGCAGTGGAAGATGGC TGG (reversed) Intronic
901444625 1:9300522-9300544 AGTTATTTGTGGATGATGGCAGG - Intronic
901503099 1:9666073-9666095 AATTAGCAGGGTATGATGGCGGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
901909454 1:12443992-12444014 AGTTAGCCGGGCACGATGGCGGG - Intronic
902329438 1:15724076-15724098 AGTAACCAGGGGCAGATGGCTGG + Intronic
902344585 1:15806672-15806694 AATTAGCAGGGCAAGGTGGCGGG + Intergenic
902377729 1:16037726-16037748 AGTTGGATGTGGAAGATGGAGGG + Intergenic
903167692 1:21532338-21532360 AATTAGCAGGGCATGATGGCAGG - Intronic
903873031 1:26450739-26450761 AGTTAGCAGAGGTAGAGAGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905565220 1:38958965-38958987 AGGTAGCAGTGGAAGAAGTGGGG + Intergenic
905806765 1:40882822-40882844 AGTTAGCAGTGGCTGAAGTCAGG - Intergenic
905981306 1:42231175-42231197 AATTAGCAGGGCATGATGGCAGG + Intronic
906289267 1:44609541-44609563 GCTTCGCTGTGGAAGATGGCAGG + Intronic
906845471 1:49186721-49186743 ACTCAGCCCTGGAAGATGGCTGG + Intronic
907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG + Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910100218 1:83567891-83567913 AGTAAGCAGTGAAAGAGGGAAGG - Intergenic
910223661 1:84915244-84915266 AGTTAGCTGGGCATGATGGCGGG - Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912799887 1:112714247-112714269 AGTTCGCTGAGGAAGGTGGCTGG - Intronic
912809221 1:112781238-112781260 AGTTAGCAAAGGAAGCTGACTGG - Intergenic
916003623 1:160639372-160639394 AATTAGCAGTGCATGGTGGCAGG - Intronic
916144235 1:161725689-161725711 AGAAAGCGGTGGGAGATGGCGGG + Intronic
916365972 1:164028089-164028111 AGTTATCTGTGGAGGAGGGCAGG + Intergenic
916621826 1:166506148-166506170 AGTTAGCTGGGCATGATGGCGGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919506490 1:198404959-198404981 AGCTAGCAGTGGCAACTGGCTGG + Intergenic
919786079 1:201259589-201259611 GCTCAGCAGGGGAAGATGGCAGG + Intergenic
920054245 1:203181096-203181118 TGTGAGCACTGGCAGATGGCAGG + Intronic
920164079 1:204023266-204023288 AATTAGCCGTGCAAGATGGCAGG + Intergenic
920167024 1:204043334-204043356 AATTAGCTGGGGATGATGGCGGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920389678 1:205591660-205591682 AGATAGCAGGGGAAGAGGGGTGG - Intronic
923446498 1:234076608-234076630 AATTAGCAGGGCATGATGGCGGG - Intronic
924032663 1:239902198-239902220 AGTTAGCATTGGGAGAAGGGAGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1062766723 10:71759-71781 AATTAGCAGTGCATGGTGGCTGG + Intergenic
1064381992 10:14852424-14852446 AGTTAACAGTGGAATATATCGGG + Exonic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065338925 10:24684785-24684807 AATTAGCCGGGCAAGATGGCGGG - Intronic
1065758909 10:28963607-28963629 AGTTAGCAGGAGAAGAGGCCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067405248 10:46016776-46016798 AGTTAGTAATGGGAGTTGGCTGG - Intronic
1068247197 10:54388596-54388618 AGCTAGCAGAAGAAGATGGTGGG - Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068926230 10:62542165-62542187 AGTTAGAGGTGTAAGATGGTTGG + Intronic
1068929698 10:62576712-62576734 AGTTAGCCGTGCGCGATGGCAGG + Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071950802 10:90700939-90700961 AGTTATCTGTGGATGATGGCAGG + Intergenic
1072965611 10:99970142-99970164 AGTTAGCAAGGAAAGATGGTAGG - Intronic
1073133644 10:101207085-101207107 AGACAGCAGGGGAAGATGGTGGG + Intergenic
1073170766 10:101506060-101506082 AATTAGCAGTGCATGGTGGCCGG - Intronic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076038837 10:127225927-127225949 AGTTAGCAGGGCATGGTGGCGGG + Intronic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077133189 11:985130-985152 AGTTAGCCGGGTATGATGGCAGG - Intronic
1077255050 11:1577511-1577533 AATTAGCAGGGCATGATGGCAGG - Intergenic
1079928316 11:26524315-26524337 AGTTAGTGTTGGAATATGGCAGG + Intronic
1080445257 11:32332313-32332335 AATTAGCCAGGGAAGATGGCAGG + Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081628279 11:44668956-44668978 AGGCAGGAGAGGAAGATGGCTGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082998351 11:59270196-59270218 AAATATCAGTGGAAGGTGGCAGG + Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1084200447 11:67553823-67553845 AGTTAGAAGTGGGAGAGGCCAGG + Intergenic
1084211701 11:67627266-67627288 AGCTTGCCGTGGAGGATGGCTGG - Intergenic
1086264875 11:84985841-84985863 AATTAGCAGGGCATGATGGCGGG + Intronic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088498716 11:110459956-110459978 AGTTATCAGTGAAACATGGCAGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089420260 11:118327086-118327108 AATTAGCAGAGCATGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090805934 11:130202165-130202187 AGGAAGCAGTGCAGGATGGCAGG - Intronic
1091666219 12:2420277-2420299 AATTAACAGTGGCAGCTGGCTGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092588693 12:9928316-9928338 AATTAGCTGTGCATGATGGCAGG + Intronic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093263641 12:16973114-16973136 AGCTAGCGGTGGTAGATGCCAGG + Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095763713 12:45870132-45870154 AGTTAGCAGGGCATGGTGGCGGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100231944 12:92617827-92617849 AGTTAGCTGTGGATGGTGGTGGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101161077 12:101976998-101977020 AGCTAGAAGTGGAAGATTGGGGG - Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101864719 12:108512198-108512220 AGCCGGTAGTGGAAGATGGCAGG - Intergenic
1102066908 12:109984593-109984615 AGTTAGCAGGGCATGGTGGCCGG - Intronic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104828424 12:131731325-131731347 GGGTAGCAGAGGAAGACGGCAGG - Intronic
1104847818 12:131855593-131855615 AGTTTGCAGTCGCAGATCGCAGG - Intergenic
1105467598 13:20660592-20660614 ATTTAGCAGTGGAGGTGGGCAGG + Intronic
1105471650 13:20700688-20700710 AGTGAGAAGTGGGAGAAGGCTGG + Intergenic
1105494353 13:20917481-20917503 AATTAGCAGGGCATGATGGCAGG - Intergenic
1106398468 13:29404370-29404392 AGTTAGCAGGGCATGGTGGCGGG + Intronic
1106605151 13:31222225-31222247 AGTTAGCCGGGCATGATGGCAGG - Intronic
1108302439 13:49092012-49092034 TGTTATCTGCGGAAGATGGCAGG + Intronic
1109023431 13:57129466-57129488 AGTTAGCAGGGCATGGTGGCGGG + Intergenic
1109457710 13:62614303-62614325 TGTTAGCAGTGGAAGAAAACTGG - Intergenic
1111060755 13:83015950-83015972 AATTAGCAGGGCATGATGGCAGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111642619 13:90988876-90988898 AGTGAGGATTGGAAAATGGCAGG + Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112261855 13:97884510-97884532 GGTTTCTAGTGGAAGATGGCAGG - Intergenic
1112934107 13:104777857-104777879 AGTTAGCTGTGCATGGTGGCAGG - Intergenic
1113191115 13:107747314-107747336 AGTTAGTTGTACAAGATGGCAGG - Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115588652 14:34841095-34841117 AATTAGCAGGGCATGATGGCGGG - Intronic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117454809 14:55886388-55886410 AGTGAGTAGTGGAAGATGGCTGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118501832 14:66369364-66369386 AGTTATCTGTGGATGATTGCAGG - Intergenic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120808585 14:88779361-88779383 ACTTATCAGTGGCAGAAGGCAGG - Intronic
1120849166 14:89153742-89153764 AGGTAACAGTTGAAGATGGCAGG + Intronic
1122026680 14:98882781-98882803 AATTAGCAGGGTATGATGGCAGG - Intergenic
1123739615 15:23224127-23224149 AGTTAGCCGGGCAAGGTGGCGGG + Intergenic
1123817817 15:23997529-23997551 AGTTATCTGTGGATGATGGCAGG + Intergenic
1124290836 15:28453098-28453120 AGTTAGCCGGGCAAGGTGGCGGG + Intergenic
1124923288 15:34047224-34047246 AGTTAGCAGGGCATGGTGGCGGG - Intronic
1127123454 15:55790568-55790590 AATTAGCCGGGCAAGATGGCGGG + Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127886394 15:63205149-63205171 AGTTAGCAGGGCATGATGGTGGG + Intronic
1128174151 15:65539367-65539389 AATTAGCAGGGCATGATGGCGGG - Intronic
1129360921 15:75023626-75023648 GGTGAGCAGTGGAAGGGGGCTGG + Exonic
1130070412 15:80642335-80642357 AATTAGCAGGGCATGATGGCGGG + Intergenic
1130528209 15:84725104-84725126 AGTTAACAGTGGGAGTTGGGAGG - Intergenic
1131129062 15:89883279-89883301 AGTTATCAATGTAAGGTGGCCGG - Intronic
1131310781 15:91288019-91288041 AGTTGGGAGGGGAAGGTGGCTGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1133216052 16:4293227-4293249 AATTAGCAGGGCATGATGGCTGG - Intergenic
1135105636 16:19646698-19646720 AGATTGCAGTAGAATATGGCAGG - Intronic
1135724015 16:24840741-24840763 AATTAGCAGGGCATGATGGCAGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136707922 16:32204559-32204581 AGTTAGCTGGGCAAGGTGGCAGG - Intergenic
1136759987 16:32724852-32724874 AGTTAGCCGGGCAAGGTGGCGGG + Intergenic
1136808117 16:33145534-33145556 AGTTAGCCGGGCAAGGTGGCGGG - Intergenic
1137505678 16:49051876-49051898 AGTCAGCAGGGGGAGATGGGTGG + Intergenic
1137951285 16:52785877-52785899 AGAAAGCAGTGGAATCTGGCTGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139218611 16:65155226-65155248 CCTTGGCAATGGAAGATGGCAGG - Intergenic
1139334183 16:66219481-66219503 AGATGGCAGTGGATGATGGATGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1141675228 16:85514143-85514165 AGAGAGCAGGGGAAGAGGGCTGG - Intergenic
1203062142 16_KI270728v1_random:985173-985195 AGTTAGCCGGGCAAGGTGGCGGG + Intergenic
1143017879 17:3901040-3901062 AGTTCCCAGTTGAAGATGGCAGG + Intronic
1143160882 17:4870054-4870076 AGTTAGCTGGGCATGATGGCGGG - Intronic
1143500503 17:7336050-7336072 AGTTAGCCGGGCATGATGGCAGG + Intergenic
1143777798 17:9210755-9210777 AATTAGCTGTGCATGATGGCAGG + Intronic
1143893608 17:10120330-10120352 TGTTAGCTGTGGAGGATGGGGGG + Intronic
1145728304 17:27153935-27153957 GGGTGTCAGTGGAAGATGGCTGG + Intergenic
1145943272 17:28755236-28755258 TGTTGGAAGTGGAAGAAGGCAGG + Intergenic
1145983321 17:29027372-29027394 AGTCAGCAGAGGAAGGAGGCTGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1147415359 17:40285339-40285361 AGTTAGCCAGGGAAGATGGATGG + Intergenic
1147872860 17:43599823-43599845 AATTAGCAGGGCATGATGGCGGG + Intergenic
1148579866 17:48736054-48736076 AGTTGGGAGAGGAAGAAGGCAGG + Intergenic
1148583546 17:48760552-48760574 AGTGTGCAGTGGAGGAAGGCGGG - Intergenic
1149253157 17:54793517-54793539 GGTTAGCATTGAGAGATGGCAGG - Intergenic
1149291929 17:55225826-55225848 AGTGAGAATTGGAAGATGGCAGG - Intergenic
1150488032 17:65557593-65557615 AGTCAGCACTGGAAGACTGCAGG + Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151477689 17:74353169-74353191 AGTTGGCAGAGGAAGATGAGTGG - Intronic
1151621522 17:75248320-75248342 AGTTAGCTGGGCAAGGTGGCGGG + Intronic
1152959565 18:71080-71102 AATTAGCAGTGCATGGTGGCTGG + Intronic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153843680 18:9029963-9029985 AGTGAGCAGTGGAACACAGCGGG - Intergenic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154290278 18:13100800-13100822 AGTTAGCAGATGAAGAAGACAGG + Intronic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157199692 18:45649364-45649386 ATTTAGGAGTGGGAGATAGCTGG - Intronic
1157225190 18:45856629-45856651 TGTTTGCGGTGGAAGATAGCAGG - Intronic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157521425 18:48348080-48348102 AGTTAGCCTTGGAAAATGCCTGG - Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160076544 18:75682855-75682877 AATTAGCAGGGCAAGGTGGCGGG - Intergenic
1161644968 19:5447557-5447579 AATTAGCCGGGCAAGATGGCGGG + Intergenic
1161825412 19:6560681-6560703 AATTAGCTGGGGAAGGTGGCAGG + Intergenic
1163190345 19:15672857-15672879 AGTTTGCAGGGGAAGTTGGAGGG - Exonic
1164503355 19:28837962-28837984 AGTGAGCAGTGGGAAAAGGCAGG - Intergenic
1165856481 19:38881564-38881586 TGTTAACAGTGGAAGAGGGGTGG - Intronic
1165870954 19:38972906-38972928 ATTTAGCAGGGCATGATGGCGGG - Intronic
1165954395 19:39492976-39492998 AGTTAGCACTAGATGAAGGCTGG - Intronic
1166036084 19:40169683-40169705 AACTAGCAGTGGCAGCTGGCTGG - Intergenic
1166143920 19:40821646-40821668 ACTTAGCAGTGTAGGAGGGCTGG + Intronic
1166183688 19:41125450-41125472 ACTTAGCAGTGTAGGAGGGCTGG - Intronic
1167094630 19:47368069-47368091 ACTGAGCAGTTGAACATGGCTGG - Intronic
1167176375 19:47867249-47867271 AATTAGCAGAGCATGATGGCGGG + Intergenic
1167181398 19:47906811-47906833 ACTGAGCAGTTGAACATGGCTGG + Intergenic
1167182062 19:47912187-47912209 ACTGAGCAGTTGAACATGGCTGG + Intergenic
1167182715 19:47917560-47917582 ACTGAGCAGTTGAACATGGCTGG + Intergenic
1167183384 19:47922911-47922933 ACTGAGCAGTTGAACATGGCTGG + Intergenic
1167184028 19:47927955-47927977 ACTGAGCAGTTGAACATGGCTGG + Intergenic
1167184680 19:47933313-47933335 ACTGAGCAGTTGAACATGGCTGG + Intergenic
1167185351 19:47938668-47938690 ACTGAGCAGTTGAACATGGCTGG + Intergenic
1167186005 19:47944054-47944076 ACTGAGCAGTTGAACATGGCTGG + Intergenic
1167186669 19:47949425-47949447 ACTGAGCAGTTGAACATGGCTGG + Intergenic
1167187320 19:47954813-47954835 ACTGAGCAGTTGAACATGGCTGG + Intergenic
1167267508 19:48491042-48491064 AGTTGGCAGTGGAACATAGGGGG + Intronic
1167541869 19:50093451-50093473 ACTGAGCAGTTGAACATGGCTGG - Intergenic
1167543849 19:50107986-50108008 ACTGAGCAGTTGAACATGGCTGG - Intergenic
1167544523 19:50113340-50113362 ACTGAGCAGTTGAACATGGCTGG - Intergenic
1167545198 19:50118690-50118712 ACTGAGCAGTTGAACATGGCTGG - Intergenic
1167545875 19:50124042-50124064 ACTGAGCAGTTGAACATGGCTGG - Intergenic
1167546552 19:50129377-50129399 ACTGAGCAGTTGAACATGGCTGG - Intergenic
1167547212 19:50134711-50134733 ACTGAGCAGTTGAACATGGCTGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1168564923 19:57414857-57414879 AGTTAGCCGGGCATGATGGCAGG - Intronic
925938320 2:8789434-8789456 AATTAGCCGGGCAAGATGGCGGG - Intronic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930651080 2:53965816-53965838 AGTTAGCCGGGCATGATGGCGGG - Intronic
932879524 2:75488197-75488219 TTTTGCCAGTGGAAGATGGCAGG - Intronic
932948589 2:76266573-76266595 AGTTGGCAGTGGGAGATAGAAGG + Intergenic
933122814 2:78563649-78563671 AATTTGCATTGTAAGATGGCAGG + Intergenic
933226100 2:79751295-79751317 AGTTAGAAATATAAGATGGCTGG + Intronic
934540235 2:95167696-95167718 AATTAGCAGGGCATGATGGCGGG + Intronic
935345666 2:102105511-102105533 AGTTAGCAGGGCATGGTGGCAGG - Intronic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935669222 2:105541245-105541267 AGTCAGCAGTGTCAGCTGGCTGG + Intergenic
935864975 2:107377324-107377346 AGTTAGGAATGGAAGAAGGGAGG + Intergenic
937278857 2:120703828-120703850 AGTGAGGAGTGAGAGATGGCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939086642 2:137727204-137727226 TGTCAGCAGTTGAAGATGGAGGG - Intergenic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939325157 2:140678924-140678946 AATTAGCAGGGCATGATGGCAGG - Intronic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943384066 2:187181119-187181141 AGCTATCTGTGGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943605243 2:189969579-189969601 AGTTAGCAAGGCATGATGGCGGG + Intronic
944813172 2:203348090-203348112 AGTTAGCTGGGCATGATGGCGGG + Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
945901705 2:215545543-215545565 AATTAGCCGGGCAAGATGGCGGG + Intergenic
946159346 2:217826627-217826649 AGTGAGGAGTGGAGGAAGGCAGG - Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948536448 2:238650865-238650887 AGCTATCAGAGGAGGATGGCCGG - Intergenic
1169363097 20:4968234-4968256 GGTTAGCCTTGAAAGATGGCGGG + Intronic
1169876427 20:10302260-10302282 AGTTGTCAGTGGTAGATGACAGG + Intronic
1170232808 20:14069095-14069117 AGTTAGCTGAGCACGATGGCGGG - Intronic
1171436116 20:25125919-25125941 AGTCATCTGAGGAAGATGGCAGG - Intergenic
1171960025 20:31486597-31486619 AGCTAGCACGGCAAGATGGCAGG + Intergenic
1172171910 20:32941101-32941123 AATTAGCAGGGCATGATGGCGGG + Intronic
1172719890 20:36991713-36991735 AGTTAGCCGGGCATGATGGCAGG + Intergenic
1174513253 20:51071960-51071982 AGTTAGGAGAGGAAGATGAGGGG - Intergenic
1174603875 20:51746400-51746422 AGTTAGGAGTGGAAGGAGGCTGG + Intronic
1174723368 20:52836986-52837008 AATTAGCAGGGCATGATGGCGGG + Intergenic
1174984918 20:55440321-55440343 AGTGACCAGTGGAACAGGGCAGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178238922 21:30876734-30876756 AGTTATCAGTGAAGGATGGATGG - Intergenic
1178605471 21:34032981-34033003 AGGTAGCAGTGGAGGGAGGCAGG - Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179667733 21:42924160-42924182 AGATAGGAGCGGAAGGTGGCGGG + Intergenic
1179970463 21:44834454-44834476 AGGAAGCAGTGGGAGGTGGCGGG - Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180931459 22:19594953-19594975 AATTAGCAGGGCATGATGGCCGG + Intergenic
1181050607 22:20236660-20236682 AGTAAGCAGTGGAACCAGGCTGG - Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1181850652 22:25747656-25747678 ATTTAGCAATGGAGGCTGGCAGG + Intronic
1182336677 22:29588147-29588169 AGTTAGCGCTGGTAGTTGGCAGG + Intergenic
1184386734 22:44181043-44181065 AGTTTGCAGTGGAAGAAGAAGGG - Exonic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1185159257 22:49213010-49213032 AATTAGCAGGGGATGGTGGCAGG - Intergenic
1185266602 22:49907243-49907265 AGGTAGCAGCGGCAGAGGGCAGG - Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951229194 3:20157293-20157315 TGTTAACAGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956788604 3:72662902-72662924 AGTCAGTAGTGGGAGATGGGGGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960466425 3:118001479-118001501 AATTAGCAATGGAAGTTGACAGG - Intergenic
960498486 3:118406224-118406246 ACACAGCAGTGGAAGATGGATGG - Intergenic
961256163 3:125555108-125555130 AGCTAGCAGGGGAATATGGAAGG + Intronic
961481155 3:127181787-127181809 AATTAGCTGGGGATGATGGCAGG + Intergenic
961499250 3:127319717-127319739 ACTTAGCAGGGCATGATGGCAGG + Intergenic
962623508 3:137202179-137202201 TGTCAGCAGTGGAAGATAGAGGG - Intergenic
964239312 3:154573517-154573539 AGTTAGTGGAGGAAGATGGCAGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965259770 3:166467262-166467284 AGTTATCCTTGGGAGATGGCAGG - Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966191399 3:177274734-177274756 AATTAGCAGGGCATGATGGCAGG - Intergenic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966946844 3:184782872-184782894 AGTTAGCTGTGCATGGTGGCAGG + Intergenic
967201293 3:187074689-187074711 ATTTGGCAGAGGAAGATGGAGGG + Intronic
967426496 3:189333236-189333258 AATTAGCTGTGCATGATGGCGGG + Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
969637905 4:8379986-8380008 AGGGAGCAGTGGAAGCTGACAGG + Intronic
970541230 4:17081943-17081965 AGTTAGCAGGGCATGGTGGCAGG - Intergenic
971334295 4:25708385-25708407 AGTTAGCTGGGCATGATGGCAGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973241319 4:47958473-47958495 AATTAGCAGGGCATGATGGCGGG + Intronic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974487121 4:62520174-62520196 AGTTTGCAGTGTAAGAGGGGTGG + Intergenic
974856689 4:67469492-67469514 AGTTAGCCGGGCATGATGGCAGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977871057 4:102091341-102091363 AATTAGCTGTGGGAGGTGGCGGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978090162 4:104706260-104706282 AGTCAGCAGTGGAAGCAGGTGGG + Intergenic
978605208 4:110472280-110472302 ACTTAGCAGGGCATGATGGCGGG - Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979278311 4:118836942-118836964 ATTTAGCAGTGAAAGATGATAGG - Intronic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980046457 4:127994436-127994458 AATTAGCAGGGCATGATGGCGGG + Intronic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980464963 4:133162901-133162923 ACTTAGCAGTGTAAGATTACAGG - Intronic
981944313 4:150323557-150323579 AGCTTGCTGTGGAAGGTGGCTGG - Intronic
982541248 4:156674562-156674584 AGTTAGGAGTGGAAAGTGTCTGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982608728 4:157546767-157546789 AGTTAGCTGAGCATGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984987568 4:185346153-185346175 AGTTAACAATAGAAAATGGCCGG - Intronic
986231330 5:5867112-5867134 GCTGAGCAGTGGGAGATGGCTGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987552771 5:19405466-19405488 AATTAGCAGGGCATGATGGCAGG - Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988507267 5:31834248-31834270 AGCTAGCAGTGGAGGAGAGCAGG - Intronic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989139734 5:38190585-38190607 AGTCAGCAGTGAAGGATGGATGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989537862 5:42584328-42584350 TTTTAGCAGAGGAACATGGCAGG + Intronic
990495129 5:56339517-56339539 AGCTAGAAGTGGAAGAAGGAAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992412690 5:76522329-76522351 AATTAGCAGGGCATGATGGCAGG - Intronic
993107271 5:83613416-83613438 AATTAGCAGAGGAGGAAGGCAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994595958 5:101835208-101835230 AGTTAGCTGGGCATGATGGCAGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996367448 5:122718086-122718108 AATTAGCAGAGCATGATGGCAGG + Intergenic
996705537 5:126494230-126494252 AGTTGGTAGTAGTAGATGGCAGG - Intronic
996848139 5:127923524-127923546 AGTTAGCAGGGCATGGTGGCGGG - Intergenic
996909526 5:128639445-128639467 AGGTAGAAGTGGAGGATGGTAGG + Intronic
997511433 5:134457522-134457544 AGTTAGCTGGGCATGATGGCGGG + Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
999145574 5:149391113-149391135 AATTAGCTGGGGATGATGGCAGG - Intronic
999541756 5:152582225-152582247 ACTTAGCAGGGCATGATGGCAGG - Intergenic
999990577 5:157046366-157046388 AGTTAGCTGGGAAAGATGACAGG + Intronic
1000330181 5:160199645-160199667 AGATAGCAGGGGGAGATGCCAGG - Intronic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001575957 5:172763888-172763910 ACTTAGCACTGGCAGATGGGTGG + Intergenic
1001779559 5:174356170-174356192 AGATGGCAGGGGAAGCTGGCAGG + Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003581574 6:7345038-7345060 AGCCAGCAGCGGCAGATGGCTGG + Intronic
1004661693 6:17716334-17716356 AGTTTTCAGTGGAAAATTGCTGG - Intergenic
1005006602 6:21293424-21293446 AGTTGGGAGGGGAAGATGGGAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007404639 6:41627511-41627533 AGTTAGCCGGGCATGATGGCGGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008444146 6:51569062-51569084 AGCTAGCTGTGGGTGATGGCTGG - Intergenic
1008533242 6:52484497-52484519 ACTTAGTAGTAGAAGATGACTGG + Intronic
1008954235 6:57197889-57197911 AATTAGCTGTGCATGATGGCAGG - Intronic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012334595 6:98039639-98039661 GGTCAGCAGTGGCAGAAGGCAGG - Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1012964129 6:105655322-105655344 AGTTATCCATAGAAGATGGCAGG - Intergenic
1013215486 6:108023686-108023708 AGTTTGCTGAGGATGATGGCAGG - Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013700280 6:112759734-112759756 AGTGAACAGTGCCAGATGGCTGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014991729 6:128088227-128088249 AGTTAGCAGGGCATGGTGGCAGG + Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015447658 6:133326215-133326237 ACTTAGCTCTGGAAGCTGGCAGG + Intronic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015862089 6:137691813-137691835 AGTTATCTGTGGATGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016214919 6:141587942-141587964 AATTTGCAGAGGAAGATGGCAGG - Intergenic
1016541572 6:145171243-145171265 AGTTAGCCGGGCATGATGGCAGG + Intergenic
1016661842 6:146590251-146590273 AGTGAGCAGTGGCAGAAGCCTGG - Intergenic
1016942523 6:149494855-149494877 AATTAGCAGGGCATGATGGCAGG + Intergenic
1017154197 6:151308359-151308381 AGTTAGCTGGGCATGATGGCAGG - Intronic
1017413476 6:154194632-154194654 AGTTAGGAGTGGTAGGTGGTAGG - Intronic
1017654802 6:156617434-156617456 AGTGAGCAGCGGAAGATGGATGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018265091 6:162015609-162015631 GGTGAGCAGTGGAAGGTGACAGG - Intronic
1018313407 6:162533377-162533399 AGTTAGCAGGGCATGGTGGCAGG + Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1022065107 7:26846830-26846852 AGTTAGCCGGGCATGATGGCAGG + Intronic
1022529126 7:31056264-31056286 AGTTGGCCTTGGAGGATGGCTGG + Intronic
1022556455 7:31302932-31302954 AATTAGCCGTGCATGATGGCGGG - Intergenic
1023559863 7:41462527-41462549 AATTAGCAGGGGATGGTGGCGGG + Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1025040574 7:55640938-55640960 AGTTAGCAGGGTATGGTGGCGGG + Intergenic
1025066829 7:55864279-55864301 AATTAGCAGGGCATGATGGCAGG - Intergenic
1026771234 7:73201149-73201171 AGTTAGCTGGGCATGATGGCGGG + Intergenic
1027012102 7:74754546-74754568 AGTTAGCTGGGCATGATGGCGGG + Intronic
1027075939 7:75191508-75191530 AGTTAGCTGGGCATGATGGCGGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030704648 7:112678927-112678949 AGTTTACAGCGGAAGTTGGCAGG + Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032827910 7:135590258-135590280 AGTTAGCTGGGCATGATGGCGGG - Intronic
1034202812 7:149293138-149293160 GGATGGCATTGGAAGATGGCTGG + Intronic
1034302057 7:150024735-150024757 AGTAAGCACTGGAAGAGAGCAGG - Intergenic
1037020527 8:13964864-13964886 AGTTGACAGTGGAAGGTGGTAGG - Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038055848 8:23856863-23856885 AGTTAGAAGTAGTAGATGCCAGG + Intergenic
1039998005 8:42551167-42551189 AATTAGCAGGGCATGATGGCGGG + Intronic
1040030987 8:42823460-42823482 ATTTATCTGTGGATGATGGCAGG + Intergenic
1040662412 8:49590021-49590043 AGTTACCAGGGGAAAATGGAGGG + Intergenic
1041969857 8:63728028-63728050 GGTCAGCAGTGGCAGGTGGCAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043526610 8:81104588-81104610 AGTTTGCAGGAGAAGATGACAGG - Intronic
1043878263 8:85510839-85510861 AGTTAGCTGGGCATGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1047453625 8:124989283-124989305 AGTTATCTGTGGATGATAGCAGG - Intergenic
1047771881 8:128036506-128036528 AGTTAGCAGTGGGAGGAGGCAGG + Intergenic
1047857337 8:128925892-128925914 AGTTAGCAGAGCATGGTGGCAGG - Intergenic
1047990543 8:130281915-130281937 AGTTAGCGGGGCAAGGTGGCGGG + Intronic
1048004386 8:130407331-130407353 AGTTAGGGATGGAAGGTGGCAGG - Intronic
1049632926 8:143668796-143668818 AATTAGCCGGGCAAGATGGCGGG + Intergenic
1049722737 8:144127339-144127361 AATTAGCAGAGCATGATGGCGGG + Intergenic
1049802026 8:144522308-144522330 GGGTAGCAATGGAAGGTGGCCGG - Exonic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051151894 9:14089249-14089271 AGTTTGGAGTGATAGATGGCGGG + Intronic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052178190 9:25490714-25490736 AATTAGCTGGGGATGATGGCAGG - Intergenic
1054786577 9:69216069-69216091 AGTTATCACTAGAAGCTGGCCGG - Intronic
1055022286 9:71683157-71683179 AATTAGCAGTGCATGGTGGCGGG + Intergenic
1055110036 9:72550507-72550529 AATTAGCAGGGCAAGCTGGCGGG + Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1055958458 9:81796355-81796377 AATTAGCCGGGCAAGATGGCGGG - Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058676156 9:107401973-107401995 AATTAGCAGGGCACGATGGCAGG + Intergenic
1059216403 9:112567807-112567829 AGTTAGCCGGGCATGATGGCAGG + Intronic
1059612415 9:115913067-115913089 AGTTTGGAGTGGAGGATGGTGGG - Intergenic
1059616350 9:115955664-115955686 AATTAGCAGGGCATGATGGCAGG + Intergenic
1060155839 9:121319129-121319151 TGTGATCAGTGGAAGATGGGAGG + Intronic
1060299019 9:122363177-122363199 AGTTAGCTGGGCAAGGTGGCGGG - Intergenic
1060493744 9:124103025-124103047 AGTTCACAGAGGAGGATGGCTGG + Intergenic
1061138680 9:128751391-128751413 AGTGAGCAGTGGAAGTGGGATGG - Exonic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062738528 9:138152552-138152574 AATTAGCAGTGCATGGTGGCTGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186860205 X:13665579-13665601 AATTAGCTGTGCATGATGGCGGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189296824 X:39924265-39924287 AGTTAGCAGGGCGTGATGGCAGG + Intergenic
1191095709 X:56671205-56671227 AGTTATCTGTGGAAGATAGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192419993 X:71021088-71021110 TGTTAGGAGTGGAGGATGGAAGG - Intergenic
1192732949 X:73819349-73819371 AGTTAGCCGGGCATGATGGCGGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194128404 X:90048692-90048714 AATTAGCCGTGCATGATGGCGGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194627581 X:96243556-96243578 TGTTAGCAGTGGAAGTTATCCGG + Intergenic
1194732592 X:97473481-97473503 AGTTAGCAGGGCATGGTGGCGGG - Intronic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196007993 X:110855830-110855852 AGTTAGCAGTGACAAATGTCAGG - Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197276087 X:124481277-124481299 ACTTAGCAGTGGTAGAAGGTAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1198169999 X:134096222-134096244 AGTTATCTGTGGAGGATGGCAGG - Intergenic
1198213175 X:134533790-134533812 AGGTAGAAGAGGAAGATGGAAGG + Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199580347 X:149354143-149354165 AGTTACCTGTGAATGATGGCAGG - Intergenic
1199621284 X:149704059-149704081 AGTTAGCAGTGGAAGATGGCTGG - Intronic
1200116251 X:153770971-153770993 AGCCAGCAGTGGAAGGAGGCAGG - Exonic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200913123 Y:8548517-8548539 AGGTGTCAGTGAAAGATGGCTGG - Intergenic
1200919588 Y:8601423-8601445 AAATATCAGTGAAAGATGGCTGG - Intergenic
1201562571 Y:15333545-15333567 AGTCAGGAGTGGCAGATGCCAGG + Intergenic
1202149250 Y:21829837-21829859 GGGTATCAGAGGAAGATGGCTGG - Intergenic
1202177602 Y:22112149-22112171 AGCTATCAATGAAAGATGGCCGG + Intergenic
1202213759 Y:22474246-22474268 AGCTATCAATGAAAGATGGCCGG - Intergenic