ID: 1199621639

View in Genome Browser
Species Human (GRCh38)
Location X:149706561-149706583
Sequence CAGAAGATGAGGTAGCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199621639_1199621644 11 Left 1199621639 X:149706561-149706583 CCAAATGGCTACCTCATCTTCTG 0: 1
1: 1
2: 1
3: 17
4: 192
Right 1199621644 X:149706595-149706617 TGAACCATAATACTTTGGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 177
1199621639_1199621643 10 Left 1199621639 X:149706561-149706583 CCAAATGGCTACCTCATCTTCTG 0: 1
1: 1
2: 1
3: 17
4: 192
Right 1199621643 X:149706594-149706616 CTGAACCATAATACTTTGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 141
1199621639_1199621642 6 Left 1199621639 X:149706561-149706583 CCAAATGGCTACCTCATCTTCTG 0: 1
1: 1
2: 1
3: 17
4: 192
Right 1199621642 X:149706590-149706612 CTATCTGAACCATAATACTTTGG 0: 1
1: 0
2: 0
3: 4
4: 96
1199621639_1199621645 12 Left 1199621639 X:149706561-149706583 CCAAATGGCTACCTCATCTTCTG 0: 1
1: 1
2: 1
3: 17
4: 192
Right 1199621645 X:149706596-149706618 GAACCATAATACTTTGGAAGGGG 0: 1
1: 0
2: 0
3: 18
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199621639 Original CRISPR CAGAAGATGAGGTAGCCATT TGG (reversed) Intronic
901495188 1:9617021-9617043 CAGAAGATCAGGAAGGAATTTGG + Intergenic
904426040 1:30423779-30423801 CAGAGGATGAGGAAGGCAGTGGG + Intergenic
905249513 1:36638913-36638935 GAGGAGATGAGGGAGCCATTGGG - Intergenic
905558705 1:38908941-38908963 CAGCAGATGGGGTAGCCAGAAGG + Intronic
906070556 1:43013426-43013448 AAGATCATGGGGTAGCCATTTGG + Intergenic
906553630 1:46688825-46688847 CAGCAGGTGAGGTAAACATTGGG - Intronic
907305145 1:53509140-53509162 CTGAGGCTGTGGTAGCCATTGGG + Exonic
910497799 1:87852530-87852552 CATAAGATAAGGTAGCACTTTGG + Intergenic
911488899 1:98537599-98537621 CAGCAGATGACTTAACCATTTGG - Intergenic
913141368 1:115944564-115944586 CAGAAGATGAGGAAGCCATTTGG + Intergenic
915871288 1:159562240-159562262 GAAAAGATGTTGTAGCCATTTGG + Intergenic
917201026 1:172515627-172515649 CAGAGGATCATGTAGCCATATGG + Intergenic
917818899 1:178740583-178740605 AAGGAGATGAGGAAGCCATTTGG + Intronic
918345064 1:183600245-183600267 CAGAAGAAGGCCTAGCCATTTGG + Intergenic
918886752 1:190202902-190202924 CAGAAGATTAGTTAACCATGAGG + Intronic
922568685 1:226618978-226619000 CAGAAGATGGGGTAGCTTCTGGG - Intergenic
1065562289 10:26975991-26976013 AAAAAGATGAGGTTGCAATTGGG - Intergenic
1065967777 10:30783202-30783224 CAAAAGATGTGGTAGCCAGGTGG + Intergenic
1067184692 10:44016609-44016631 CAGAAGATGAGGTGGACACCAGG - Intergenic
1067231676 10:44416604-44416626 CAGAAACTGAGCCAGCCATTGGG + Intergenic
1067713163 10:48666400-48666422 TAGAACATCAGGAAGCCATTAGG - Intergenic
1070749235 10:78954212-78954234 CAGAAGAAGAGAGAGCCAATTGG + Intergenic
1072680341 10:97501182-97501204 CTGAAGATGAAGTTGCCTTTGGG - Intronic
1073117269 10:101098308-101098330 GATAAGCTGAGGTGGCCATTTGG - Intronic
1075263667 10:120983104-120983126 CAGAATGTGATGAAGCCATTTGG - Intergenic
1075376528 10:121982316-121982338 CAGGAGATGAGTTAGAGATTGGG + Intergenic
1076123499 10:127954945-127954967 CAGAAGATAAGGATGCCACTTGG + Intronic
1077280241 11:1741381-1741403 TAGAGGATGAGGCAGCCATGTGG + Intronic
1077564797 11:3290730-3290752 CAGAAGCAGGGTTAGCCATTGGG - Intergenic
1077674654 11:4185465-4185487 CAGAAGCAGAAGTAGGCATTGGG + Intergenic
1078060085 11:8037682-8037704 CAGAAGGTGATGTTGTCATTAGG + Intronic
1079092419 11:17490420-17490442 CAGAAGCAGAGGAAGTCATTTGG + Intergenic
1079928360 11:26524895-26524917 CAGCATATGAGGTCGTCATTGGG - Intronic
1080501286 11:32873775-32873797 CAGAAGAAGAGATAGCTGTTAGG + Intergenic
1080554016 11:33399520-33399542 CAGGAGATGAGCTGGCCATCTGG + Intergenic
1084445027 11:69198597-69198619 CAGAACAGGAGGGAGCCATTAGG + Intergenic
1085649456 11:78254395-78254417 AAGAAGATGAAGTAGGGATTAGG + Intronic
1087286011 11:96265829-96265851 CAGCAGATGGGGGAGCCATAAGG - Intronic
1087788720 11:102384729-102384751 CAGCAGATGAGGGAGCCAGAAGG + Intergenic
1093655971 12:21694688-21694710 CAGCAGATGAGGGAGCCAGAAGG + Intronic
1093911061 12:24747918-24747940 CAGAAGAAGAGCTAGCTATGAGG + Intergenic
1094249286 12:28340957-28340979 CAGCAGATGGGGTAGCCAGAAGG + Intronic
1095376147 12:41531225-41531247 CAGGAGATGAGGGAGCCAGAAGG + Intronic
1095839016 12:46671275-46671297 AAGAAGATGAGAGAGCCATGTGG + Intergenic
1097624615 12:61984567-61984589 CAAAAGAGGAGGTAGCCATGAGG + Intronic
1097826705 12:64181605-64181627 CACCAGATGAGGAAGGCATTTGG + Intergenic
1098975591 12:76898921-76898943 CACGAGATGAGGTAGCGAGTGGG - Intergenic
1099145262 12:79035569-79035591 CAGAAGAGGAGGAAGGCATGAGG - Intronic
1104035365 12:125093653-125093675 CAGAAGCTGCGGGAGCCATGGGG - Intronic
1104070503 12:125341019-125341041 CACAAGATGAGGTCACTATTTGG - Intronic
1104189222 12:126462471-126462493 CTGAAGATGAAATAGTCATTTGG + Intergenic
1104680000 12:130743469-130743491 CAGAAGAGGAGAAAGTCATTAGG + Intergenic
1105594947 13:21828338-21828360 CAGCAGATGAGGGAGCCAAAAGG - Intergenic
1106452792 13:29898402-29898424 CAGAAGAAGAGGTGACCATATGG - Intergenic
1108911821 13:55563491-55563513 CTGAAGATATTGTAGCCATTTGG - Intergenic
1110772607 13:79367004-79367026 GAGAAGATCAGGTAGCTCTTGGG - Intronic
1111156786 13:84338124-84338146 CAGCAGGTGAGGGAGCCATAAGG + Intergenic
1117603659 14:57402137-57402159 TAGAAGATATGGTAGCTATTTGG + Intronic
1118029635 14:61807726-61807748 CAGAAGGCAAGGCAGCCATTTGG - Intergenic
1120376689 14:83717509-83717531 CTGAACATGGTGTAGCCATTTGG + Intergenic
1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG + Intergenic
1125890843 15:43266064-43266086 CTGGAGATGAGGCTGCCATTGGG + Intronic
1126881850 15:53107262-53107284 CAGAAGATCATGTAGACATGAGG - Intergenic
1127144063 15:56007084-56007106 CAGCAGAGGAGGTAGCCAATGGG - Intergenic
1136627995 16:31473371-31473393 CAGAAGATAAGGTTCCCAGTGGG - Intronic
1141252324 16:82369898-82369920 AAGAAGGTGAGGTGGGCATTGGG - Intergenic
1144291208 17:13828246-13828268 CAGAAGATGAAGTAGGAATTAGG - Intergenic
1144407088 17:14962515-14962537 AGGTAGATGAGGTACCCATTTGG - Intergenic
1146033491 17:29386525-29386547 CAGAAGAAGAGGGAGAAATTTGG + Intergenic
1146793645 17:35766624-35766646 AAGAAGATGATGGAGCCATCGGG + Exonic
1148111323 17:45146047-45146069 CTGAAGATGGGGTAACAATTTGG + Intergenic
1148472556 17:47904279-47904301 AAGAAGTAGAAGTAGCCATTAGG + Intronic
1150130098 17:62664550-62664572 CTGAAGATGAGGAAGACGTTGGG - Exonic
1151830781 17:76548871-76548893 CAGAAGCTGAGGCAGTCATGGGG - Intronic
1152880821 17:82813893-82813915 CAGGAGGTGAGGCAGCCACTGGG + Intronic
1153289092 18:3482739-3482761 CAGAAGATGAGGTGACACTTTGG - Intergenic
1156188417 18:34690228-34690250 CACAAAATGAGGCGGCCATTTGG - Intronic
1157030060 18:43894776-43894798 CTTAAGCTGAGGTAGCCACTCGG - Intergenic
1158169696 18:54583526-54583548 TAGAAGATGAGGTAGACATTTGG - Intergenic
1158348852 18:56543744-56543766 CAAAAGATGAGGAATACATTTGG + Intergenic
1163782031 19:19255625-19255647 GAGAAAATGAGGCAGCCAGTGGG - Exonic
1164913113 19:32028084-32028106 CAGAGGATGACGGAGCCAGTAGG + Intergenic
1167025215 19:46911064-46911086 CAGAAGATGAGATGGGCAGTCGG - Intergenic
925828099 2:7870167-7870189 CATAAGAAGAGGTAGCCACAGGG + Intergenic
926824849 2:16895118-16895140 CTGAAGAAGAGGTAGACAATAGG + Intergenic
926929690 2:18024371-18024393 AAGAAGATGAGGGACTCATTGGG - Intronic
926953588 2:18270859-18270881 CTGAAAATGAGTTATCCATTTGG - Intronic
927088808 2:19694900-19694922 CACATGATGAGGTAGCCCTAGGG + Intergenic
928537919 2:32258096-32258118 CAGCAGATGGGGTAGCCAGAAGG + Intronic
929752377 2:44729157-44729179 CAGAGTAAGAGATAGCCATTTGG + Intronic
931128101 2:59299841-59299863 CAGAAAATGAGATAACCATTAGG + Intergenic
935557334 2:104524398-104524420 CAGAAAGTGATTTAGCCATTTGG - Intergenic
937221151 2:120344017-120344039 CAGAAGAAGAGGTAGGCGATAGG + Intergenic
938450400 2:131413776-131413798 CAAGAGATGAGATACCCATTTGG + Intergenic
941210716 2:162635223-162635245 CAGGATATGAGCTAGACATTGGG + Intronic
941721233 2:168815253-168815275 AAGAAGCTGAGGTAGCTAATTGG - Intronic
941756174 2:169188691-169188713 CAGATAATGAGATAGCCAGTAGG + Intronic
942487710 2:176456687-176456709 CAGAAGAAGAGGAAACCAATAGG - Intergenic
948189573 2:236047290-236047312 CAGAAGCAGAGGGAGCCAGTGGG + Intronic
1169877425 20:10313329-10313351 CAGAAGCTGAGCTACCCAGTGGG - Intergenic
1173421630 20:42906380-42906402 CAGCAGATGAGGGAGCCATGAGG - Intronic
1173552258 20:43940672-43940694 CAGAGGATGAGGCAGCTATCAGG + Intronic
1177601293 21:23318247-23318269 CAGAAGATGAGGGAGCCAGAAGG + Intergenic
1180969821 22:19809364-19809386 CAGCAGATGAGGGAGCCAGAAGG - Intronic
1181603880 22:23968112-23968134 CAGAAGAGGAGGTTGCCAACTGG - Intronic
1181604633 22:23973195-23973217 CAGAAGAGGAGGTTGCCAACTGG + Intronic
1181970816 22:26688502-26688524 AAGATAATGAGGTAGCCAGTGGG + Intergenic
949782667 3:7707639-7707661 CAGAAGATGGTGGAGCCTTTAGG + Intronic
949889462 3:8722813-8722835 GAAAAGATGAGGTATACATTGGG - Intronic
950370154 3:12522524-12522546 CTGAAGATGAGGTAGAGTTTAGG - Intronic
951956622 3:28262439-28262461 CAGCAGAGGAGGTGACCATTTGG + Intronic
952151832 3:30601755-30601777 CTGAAGATGAGGAAGACAGTAGG - Intergenic
952716560 3:36486060-36486082 CAGGAGATGTGGTAGGCAGTTGG + Intronic
953473094 3:43183240-43183262 CAGAAGATGAAGGAGCCAGAAGG + Intergenic
953628844 3:44593923-44593945 GACAAGATGTGGTAGCCATATGG - Intronic
953738092 3:45513455-45513477 CAGAAGCTGAGGTGGCACTTTGG - Intronic
955110194 3:55941435-55941457 CTGGAGCTGAGATAGCCATTTGG - Intronic
958025205 3:88041215-88041237 CAGCAGATAGGGAAGCCATTTGG - Intergenic
959241855 3:103807223-103807245 TCAAAGATGAGATAGCCATTGGG + Intergenic
959366878 3:105471950-105471972 CAGAGGCTGGGGTAGTCATTGGG - Intronic
960415799 3:117383410-117383432 CAGCAGATGAGGGAGCCAGAAGG - Intergenic
960438922 3:117662817-117662839 CACAATGTGAGGTAGTCATTGGG - Intergenic
964241867 3:154603683-154603705 CAGAACATGCTTTAGCCATTAGG - Intergenic
964540655 3:157775740-157775762 TAGAAGATGAGTTGGTCATTAGG - Intergenic
966217692 3:177519921-177519943 CAGCAGATGGGGGAGCCAGTAGG - Intergenic
968635677 4:1677429-1677451 GAGAAGAGGAGGGAGCCCTTGGG - Intronic
970576958 4:17437193-17437215 CAGCAGATGGGGGAGCCATAAGG + Intergenic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
971557335 4:28030512-28030534 CAGAATAAGATGTAGACATTTGG + Intergenic
972407140 4:38757468-38757490 CAGAAGAAGAGATTGACATTGGG + Intergenic
975774952 4:77776305-77776327 CAGCAGAGGAGGTAGCCAATGGG - Exonic
975901265 4:79156004-79156026 ACTAAGATGAGATAGCCATTTGG - Intergenic
975959464 4:79884326-79884348 CAGAAGATTAGGCACTCATTAGG + Intergenic
976204984 4:82616147-82616169 TATAAGATGTGGTATCCATTTGG - Intergenic
978382212 4:108141318-108141340 CAGAAAATGAGGTTACAATTGGG - Intronic
979088918 4:116453196-116453218 CAGCAGATGAGGAAGCCAGAGGG + Intergenic
979860078 4:125682805-125682827 CAGAAGATGGGGAAGCCAGAGGG + Intergenic
982947781 4:161648048-161648070 CAGCAGATGGGGGAGCCAGTAGG - Intronic
983051106 4:163048641-163048663 CAGAAGATGAAGCAGCCACCTGG - Intergenic
984249158 4:177310726-177310748 CAGACGATGTGGTATTCATTTGG + Intronic
985285080 4:188329065-188329087 CATAAGATAAGGTAGACAATAGG + Intergenic
985791931 5:1933514-1933536 CAGGGGATGAGGGAGTCATTTGG - Intergenic
987008519 5:13736256-13736278 CAGCAAGCGAGGTAGCCATTAGG + Intronic
987179162 5:15348276-15348298 CAGAAGACAGGGTAGCCAGTGGG - Intergenic
990183806 5:53191416-53191438 CACAAAACGAGGTGGCCATTTGG - Intergenic
990514284 5:56517491-56517513 CTGAAGCTGAGGCAGCCCTTGGG - Intronic
991948740 5:71927235-71927257 GAGATGCTGTGGTAGCCATTTGG - Intergenic
994643589 5:102441308-102441330 CAGTAGATGTGATAGCCAATTGG - Intronic
996569117 5:124913097-124913119 CAGCAGATGAGGGAGCCAGAGGG + Intergenic
996772109 5:127096923-127096945 CATCAGATGTGGTAGCCATCAGG - Intergenic
997075883 5:130676216-130676238 CAGAAGTTGAGGATGCAATTAGG + Intergenic
1000331228 5:160207181-160207203 CAGAAGATGAGGTAGGGAAATGG + Intronic
1003747076 6:9014554-9014576 CAGAATATGAGTGAGCCAGTAGG + Intergenic
1004996956 6:21202915-21202937 GATAAGATGAGGAAGCCAGTTGG + Intronic
1005765938 6:29012165-29012187 GAGAAGATTAAGCAGCCATTTGG + Intergenic
1007043448 6:38747329-38747351 CAGAAAATTAGCCAGCCATTTGG - Intronic
1007402941 6:41614892-41614914 CAGAAGAGGAGGTAGCCACCTGG + Intergenic
1007852773 6:44821186-44821208 AAGAAGGTAAGGTAGCCATGAGG + Intronic
1010823069 6:80439016-80439038 CAGAGGATGAGGGAGCAATTAGG - Intergenic
1011801605 6:91022178-91022200 CAGAAGATGGGGAAGCCAGAAGG - Intergenic
1014247244 6:119081675-119081697 CAGCAGATGGGGTAGCCAGAAGG + Intronic
1015127713 6:129772744-129772766 CAAGAGATGAGGTAGGCATTTGG - Intergenic
1016382989 6:143504155-143504177 AGGAACTTGAGGTAGCCATTAGG - Exonic
1020343552 7:7138616-7138638 TAGAAGAGGAGGGAGCAATTAGG + Intergenic
1020442728 7:8235395-8235417 AAGTAGATGTGGTAACCATTTGG - Intronic
1020802814 7:12753140-12753162 CAGAAGCTGATGAAGACATTAGG + Intergenic
1021508415 7:21410010-21410032 AAGGAGATGAGGGAGCCACTAGG - Intergenic
1022052949 7:26697120-26697142 CAGAAGATGAGGTAAACTGTGGG + Intronic
1024234755 7:47389594-47389616 CAGAAGAGGAGGGTGGCATTGGG - Intronic
1025003905 7:55340837-55340859 CAGAAGAGGAGGTGGCAATGTGG - Intergenic
1027134384 7:75613740-75613762 CAGAAGGTGAGGCAGACAGTAGG - Intronic
1027299154 7:76811418-76811440 GAGAAGATGAACTAGCAATTTGG - Intergenic
1031397773 7:121293589-121293611 CACAAAATGGGGCAGCCATTTGG - Intronic
1031398309 7:121300694-121300716 CAGTAGATGAGTAAGCCCTTCGG - Intergenic
1032322102 7:130894883-130894905 CAGAGAATGGGGGAGCCATTAGG + Intergenic
1033418500 7:141185369-141185391 CAGCAGATGAGGGAGCCAGAAGG + Intronic
1034623470 7:152474477-152474499 AGGAAGATGAGGTAGCAAATAGG - Intergenic
1036563524 8:9918460-9918482 CGGGGGAGGAGGTAGCCATTAGG + Intergenic
1037645276 8:20787326-20787348 AAGAAGATGAGGTATTCAGTGGG - Intergenic
1038989888 8:32856621-32856643 CAGAAGATGTGATGGCCCTTTGG - Intergenic
1041721579 8:60980932-60980954 CAGAAGAGGAGGAGGCCATGTGG + Intergenic
1042478778 8:69280258-69280280 TAGAAAATGGGGCAGCCATTTGG + Intergenic
1044216854 8:89622468-89622490 TAGAAGATGAGGTAACCACTTGG + Intergenic
1045618869 8:103951658-103951680 CACAAAACTAGGTAGCCATTTGG + Intronic
1045731730 8:105249604-105249626 CACTAGAGGATGTAGCCATTAGG - Intronic
1046229512 8:111335130-111335152 CAGCAGATGCGGGAGCCATTAGG + Intergenic
1048298522 8:133234435-133234457 CAAAAGGTCAGGTAGCCCTTGGG + Intergenic
1048493732 8:134918436-134918458 AAGAAGAAAAGGTAGCCAGTGGG - Intergenic
1050138207 9:2490514-2490536 CAAAAGATGGGGTAGCAACTTGG - Intergenic
1050944566 9:11500840-11500862 CAGTAGATGAGGAAGCCAGAAGG + Intergenic
1051385974 9:16509152-16509174 CTGAAGATGAAGTGGACATTTGG - Intronic
1051504752 9:17814624-17814646 TAGTAAATGAGGTATCCATTAGG - Intergenic
1051795370 9:20862702-20862724 CTGAATATGAGGTATGCATTTGG + Exonic
1051984768 9:23070735-23070757 CAGAGGCTGAGGTGGCCAGTGGG + Intergenic
1054855089 9:69890888-69890910 CAGAGGATTAGGAAGCCATGGGG + Intronic
1056825830 9:89875771-89875793 CAGATGATGAAGTAGCCAGCTGG - Intergenic
1057174999 9:92989735-92989757 CATAAGATGAGGTAAACATAGGG + Intronic
1059056352 9:110985174-110985196 CAAAACATAAGGTAGTCATTTGG - Intronic
1203625228 Un_KI270750v1:11596-11618 CAGCAGATGAGGTAGCCAGAAGG - Intergenic
1185871806 X:3670839-3670861 CAGAAAATGAGTTTGCCACTTGG - Intronic
1186310808 X:8316737-8316759 CAGGACATGAGGCAGCCATGTGG + Intergenic
1187854115 X:23620241-23620263 CACAAGCTGAGGGAGACATTTGG + Intergenic
1189711688 X:43819407-43819429 CTGAAGATGAGATGGCCCTTGGG - Intronic
1194770786 X:97902191-97902213 GAAAAGATGAGGTTGCCATCAGG + Intergenic
1195161260 X:102173991-102174013 AAGAAGATGAGGTAGTCAGTGGG - Intergenic
1196258879 X:113554737-113554759 CAGCAGATGAGGAAGCCAGAAGG + Intergenic
1197843152 X:130771824-130771846 CACAAGATGAGACAGCCAGTAGG - Intronic
1199018389 X:142847068-142847090 CAGCAGATGGGGAAGCCAGTAGG + Intergenic
1199143307 X:144335910-144335932 CAGCAGATGAGGGAGCCAGAAGG + Intergenic
1199616364 X:149659215-149659237 CAGGAGATGATGAAGCCTTTTGG + Intergenic
1199621639 X:149706561-149706583 CAGAAGATGAGGTAGCCATTTGG - Intronic
1200290078 X:154863488-154863510 TAAAAGTTGAGGAAGCCATTTGG + Intronic