ID: 1199623993 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:149723656-149723678 |
| Sequence | AACAACTGAACTGAATATCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199623993_1199623995 | 7 | Left | 1199623993 | X:149723656-149723678 | CCATGATATTCAGTTCAGTTGTT | No data | ||
| Right | 1199623995 | X:149723686-149723708 | CCCACTAAACATTCCCCAAGAGG | No data | ||||
| 1199623993_1199624001 | 24 | Left | 1199623993 | X:149723656-149723678 | CCATGATATTCAGTTCAGTTGTT | No data | ||
| Right | 1199624001 | X:149723703-149723725 | AAGAGGATTAATAGGACAGATGG | No data | ||||
| 1199623993_1199623997 | 16 | Left | 1199623993 | X:149723656-149723678 | CCATGATATTCAGTTCAGTTGTT | No data | ||
| Right | 1199623997 | X:149723695-149723717 | CATTCCCCAAGAGGATTAATAGG | No data | ||||
| 1199623993_1199624002 | 25 | Left | 1199623993 | X:149723656-149723678 | CCATGATATTCAGTTCAGTTGTT | No data | ||
| Right | 1199624002 | X:149723704-149723726 | AGAGGATTAATAGGACAGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199623993 | Original CRISPR | AACAACTGAACTGAATATCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||