ID: 1199623993

View in Genome Browser
Species Human (GRCh38)
Location X:149723656-149723678
Sequence AACAACTGAACTGAATATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199623993_1199623995 7 Left 1199623993 X:149723656-149723678 CCATGATATTCAGTTCAGTTGTT No data
Right 1199623995 X:149723686-149723708 CCCACTAAACATTCCCCAAGAGG No data
1199623993_1199624001 24 Left 1199623993 X:149723656-149723678 CCATGATATTCAGTTCAGTTGTT No data
Right 1199624001 X:149723703-149723725 AAGAGGATTAATAGGACAGATGG No data
1199623993_1199623997 16 Left 1199623993 X:149723656-149723678 CCATGATATTCAGTTCAGTTGTT No data
Right 1199623997 X:149723695-149723717 CATTCCCCAAGAGGATTAATAGG No data
1199623993_1199624002 25 Left 1199623993 X:149723656-149723678 CCATGATATTCAGTTCAGTTGTT No data
Right 1199624002 X:149723704-149723726 AGAGGATTAATAGGACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199623993 Original CRISPR AACAACTGAACTGAATATCA TGG (reversed) Intergenic
No off target data available for this crispr