ID: 1199623994

View in Genome Browser
Species Human (GRCh38)
Location X:149723686-149723708
Sequence CCTCTTGGGGAATGTTTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199623994_1199624003 1 Left 1199623994 X:149723686-149723708 CCCACTAAACATTCCCCAAGAGG No data
Right 1199624003 X:149723710-149723732 TTAATAGGACAGATGGGCCCAGG No data
1199623994_1199624007 20 Left 1199623994 X:149723686-149723708 CCCACTAAACATTCCCCAAGAGG No data
Right 1199624007 X:149723729-149723751 CAGGGCTGCACTTTCTAGAATGG No data
1199623994_1199624001 -6 Left 1199623994 X:149723686-149723708 CCCACTAAACATTCCCCAAGAGG No data
Right 1199624001 X:149723703-149723725 AAGAGGATTAATAGGACAGATGG No data
1199623994_1199624002 -5 Left 1199623994 X:149723686-149723708 CCCACTAAACATTCCCCAAGAGG No data
Right 1199624002 X:149723704-149723726 AGAGGATTAATAGGACAGATGGG No data
1199623994_1199624008 21 Left 1199623994 X:149723686-149723708 CCCACTAAACATTCCCCAAGAGG No data
Right 1199624008 X:149723730-149723752 AGGGCTGCACTTTCTAGAATGGG No data
1199623994_1199624004 2 Left 1199623994 X:149723686-149723708 CCCACTAAACATTCCCCAAGAGG No data
Right 1199624004 X:149723711-149723733 TAATAGGACAGATGGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199623994 Original CRISPR CCTCTTGGGGAATGTTTAGT GGG (reversed) Intergenic
No off target data available for this crispr