ID: 1199623996

View in Genome Browser
Species Human (GRCh38)
Location X:149723687-149723709
Sequence TCCTCTTGGGGAATGTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199623996_1199624008 20 Left 1199623996 X:149723687-149723709 CCACTAAACATTCCCCAAGAGGA No data
Right 1199624008 X:149723730-149723752 AGGGCTGCACTTTCTAGAATGGG No data
1199623996_1199624004 1 Left 1199623996 X:149723687-149723709 CCACTAAACATTCCCCAAGAGGA No data
Right 1199624004 X:149723711-149723733 TAATAGGACAGATGGGCCCAGGG No data
1199623996_1199624007 19 Left 1199623996 X:149723687-149723709 CCACTAAACATTCCCCAAGAGGA No data
Right 1199624007 X:149723729-149723751 CAGGGCTGCACTTTCTAGAATGG No data
1199623996_1199624001 -7 Left 1199623996 X:149723687-149723709 CCACTAAACATTCCCCAAGAGGA No data
Right 1199624001 X:149723703-149723725 AAGAGGATTAATAGGACAGATGG No data
1199623996_1199624002 -6 Left 1199623996 X:149723687-149723709 CCACTAAACATTCCCCAAGAGGA No data
Right 1199624002 X:149723704-149723726 AGAGGATTAATAGGACAGATGGG No data
1199623996_1199624003 0 Left 1199623996 X:149723687-149723709 CCACTAAACATTCCCCAAGAGGA No data
Right 1199624003 X:149723710-149723732 TTAATAGGACAGATGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199623996 Original CRISPR TCCTCTTGGGGAATGTTTAG TGG (reversed) Intergenic
No off target data available for this crispr