ID: 1199623999

View in Genome Browser
Species Human (GRCh38)
Location X:149723700-149723722
Sequence TCTGTCCTATTAATCCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199623999_1199624009 27 Left 1199623999 X:149723700-149723722 CCCAAGAGGATTAATAGGACAGA No data
Right 1199624009 X:149723750-149723772 GGGTTTTTTGCCCACATAATAGG No data
1199623999_1199624008 7 Left 1199623999 X:149723700-149723722 CCCAAGAGGATTAATAGGACAGA No data
Right 1199624008 X:149723730-149723752 AGGGCTGCACTTTCTAGAATGGG No data
1199623999_1199624007 6 Left 1199623999 X:149723700-149723722 CCCAAGAGGATTAATAGGACAGA No data
Right 1199624007 X:149723729-149723751 CAGGGCTGCACTTTCTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199623999 Original CRISPR TCTGTCCTATTAATCCTCTT GGG (reversed) Intergenic
No off target data available for this crispr