ID: 1199624000

View in Genome Browser
Species Human (GRCh38)
Location X:149723701-149723723
Sequence ATCTGTCCTATTAATCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199624000_1199624009 26 Left 1199624000 X:149723701-149723723 CCAAGAGGATTAATAGGACAGAT No data
Right 1199624009 X:149723750-149723772 GGGTTTTTTGCCCACATAATAGG No data
1199624000_1199624007 5 Left 1199624000 X:149723701-149723723 CCAAGAGGATTAATAGGACAGAT No data
Right 1199624007 X:149723729-149723751 CAGGGCTGCACTTTCTAGAATGG No data
1199624000_1199624008 6 Left 1199624000 X:149723701-149723723 CCAAGAGGATTAATAGGACAGAT No data
Right 1199624008 X:149723730-149723752 AGGGCTGCACTTTCTAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199624000 Original CRISPR ATCTGTCCTATTAATCCTCT TGG (reversed) Intergenic
No off target data available for this crispr