ID: 1199624002

View in Genome Browser
Species Human (GRCh38)
Location X:149723704-149723726
Sequence AGAGGATTAATAGGACAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199623994_1199624002 -5 Left 1199623994 X:149723686-149723708 CCCACTAAACATTCCCCAAGAGG No data
Right 1199624002 X:149723704-149723726 AGAGGATTAATAGGACAGATGGG No data
1199623996_1199624002 -6 Left 1199623996 X:149723687-149723709 CCACTAAACATTCCCCAAGAGGA No data
Right 1199624002 X:149723704-149723726 AGAGGATTAATAGGACAGATGGG No data
1199623993_1199624002 25 Left 1199623993 X:149723656-149723678 CCATGATATTCAGTTCAGTTGTT No data
Right 1199624002 X:149723704-149723726 AGAGGATTAATAGGACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199624002 Original CRISPR AGAGGATTAATAGGACAGAT GGG Intergenic
No off target data available for this crispr