ID: 1199624007

View in Genome Browser
Species Human (GRCh38)
Location X:149723729-149723751
Sequence CAGGGCTGCACTTTCTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199623994_1199624007 20 Left 1199623994 X:149723686-149723708 CCCACTAAACATTCCCCAAGAGG No data
Right 1199624007 X:149723729-149723751 CAGGGCTGCACTTTCTAGAATGG No data
1199623999_1199624007 6 Left 1199623999 X:149723700-149723722 CCCAAGAGGATTAATAGGACAGA No data
Right 1199624007 X:149723729-149723751 CAGGGCTGCACTTTCTAGAATGG No data
1199623996_1199624007 19 Left 1199623996 X:149723687-149723709 CCACTAAACATTCCCCAAGAGGA No data
Right 1199624007 X:149723729-149723751 CAGGGCTGCACTTTCTAGAATGG No data
1199624000_1199624007 5 Left 1199624000 X:149723701-149723723 CCAAGAGGATTAATAGGACAGAT No data
Right 1199624007 X:149723729-149723751 CAGGGCTGCACTTTCTAGAATGG No data
1199623998_1199624007 7 Left 1199623998 X:149723699-149723721 CCCCAAGAGGATTAATAGGACAG No data
Right 1199624007 X:149723729-149723751 CAGGGCTGCACTTTCTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199624007 Original CRISPR CAGGGCTGCACTTTCTAGAA TGG Intergenic
No off target data available for this crispr