ID: 1199626033

View in Genome Browser
Species Human (GRCh38)
Location X:149742485-149742507
Sequence TGATCCTCGGGTGCTCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199626033_1199626041 -2 Left 1199626033 X:149742485-149742507 CCCTCTGGAGCACCCGAGGATCA No data
Right 1199626041 X:149742506-149742528 CAGGGGAAGCCTTAAGGACGAGG No data
1199626033_1199626040 -8 Left 1199626033 X:149742485-149742507 CCCTCTGGAGCACCCGAGGATCA No data
Right 1199626040 X:149742500-149742522 GAGGATCAGGGGAAGCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199626033 Original CRISPR TGATCCTCGGGTGCTCCAGA GGG (reversed) Intergenic
No off target data available for this crispr