ID: 1199627076

View in Genome Browser
Species Human (GRCh38)
Location X:149750630-149750652
Sequence CCCCAACCTGGGGCTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199627076_1199627083 15 Left 1199627076 X:149750630-149750652 CCCAGGGAAGCCCCAGGTTGGGG No data
Right 1199627083 X:149750668-149750690 TTCACCTTAGAACAAATATCTGG No data
1199627076_1199627085 20 Left 1199627076 X:149750630-149750652 CCCAGGGAAGCCCCAGGTTGGGG No data
Right 1199627085 X:149750673-149750695 CTTAGAACAAATATCTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199627076 Original CRISPR CCCCAACCTGGGGCTTCCCT GGG (reversed) Intergenic
No off target data available for this crispr