ID: 1199627888

View in Genome Browser
Species Human (GRCh38)
Location X:149757702-149757724
Sequence CTGCAGTCCTTAGGAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199627884_1199627888 -7 Left 1199627884 X:149757686-149757708 CCTAGCTGCTGCAGCCCTGCAGT No data
Right 1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG No data
1199627882_1199627888 26 Left 1199627882 X:149757653-149757675 CCTGTAGGAGAGGATGTGGGGTG No data
Right 1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199627888 Original CRISPR CTGCAGTCCTTAGGAAACAC AGG Intergenic
No off target data available for this crispr