ID: 1199628018

View in Genome Browser
Species Human (GRCh38)
Location X:149758289-149758311
Sequence CGAGGGAAACAGAGGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199628008_1199628018 29 Left 1199628008 X:149758237-149758259 CCAGACTTGGGCATGCTCTGCTC No data
Right 1199628018 X:149758289-149758311 CGAGGGAAACAGAGGAAGCTGGG No data
1199628010_1199628018 1 Left 1199628010 X:149758265-149758287 CCAGTATGCCATCATAAGAGAGG No data
Right 1199628018 X:149758289-149758311 CGAGGGAAACAGAGGAAGCTGGG No data
1199628009_1199628018 2 Left 1199628009 X:149758264-149758286 CCCAGTATGCCATCATAAGAGAG No data
Right 1199628018 X:149758289-149758311 CGAGGGAAACAGAGGAAGCTGGG No data
1199628014_1199628018 -7 Left 1199628014 X:149758273-149758295 CCATCATAAGAGAGGCCGAGGGA No data
Right 1199628018 X:149758289-149758311 CGAGGGAAACAGAGGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199628018 Original CRISPR CGAGGGAAACAGAGGAAGCT GGG Intergenic
No off target data available for this crispr