ID: 1199628360

View in Genome Browser
Species Human (GRCh38)
Location X:149760198-149760220
Sequence CCCCTACCTGGGGCCTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199628360_1199628370 11 Left 1199628360 X:149760198-149760220 CCCCTGGAGGCCCCAGGTAGGGG No data
Right 1199628370 X:149760232-149760254 ATGCTCACATTTCTGCCAGGTGG No data
1199628360_1199628375 21 Left 1199628360 X:149760198-149760220 CCCCTGGAGGCCCCAGGTAGGGG No data
Right 1199628375 X:149760242-149760264 TTCTGCCAGGTGGTTGGGGGTGG No data
1199628360_1199628376 22 Left 1199628360 X:149760198-149760220 CCCCTGGAGGCCCCAGGTAGGGG No data
Right 1199628376 X:149760243-149760265 TCTGCCAGGTGGTTGGGGGTGGG No data
1199628360_1199628372 16 Left 1199628360 X:149760198-149760220 CCCCTGGAGGCCCCAGGTAGGGG No data
Right 1199628372 X:149760237-149760259 CACATTTCTGCCAGGTGGTTGGG No data
1199628360_1199628374 18 Left 1199628360 X:149760198-149760220 CCCCTGGAGGCCCCAGGTAGGGG No data
Right 1199628374 X:149760239-149760261 CATTTCTGCCAGGTGGTTGGGGG No data
1199628360_1199628377 25 Left 1199628360 X:149760198-149760220 CCCCTGGAGGCCCCAGGTAGGGG No data
Right 1199628377 X:149760246-149760268 GCCAGGTGGTTGGGGGTGGGAGG No data
1199628360_1199628368 8 Left 1199628360 X:149760198-149760220 CCCCTGGAGGCCCCAGGTAGGGG No data
Right 1199628368 X:149760229-149760251 GCCATGCTCACATTTCTGCCAGG No data
1199628360_1199628373 17 Left 1199628360 X:149760198-149760220 CCCCTGGAGGCCCCAGGTAGGGG No data
Right 1199628373 X:149760238-149760260 ACATTTCTGCCAGGTGGTTGGGG No data
1199628360_1199628371 15 Left 1199628360 X:149760198-149760220 CCCCTGGAGGCCCCAGGTAGGGG No data
Right 1199628371 X:149760236-149760258 TCACATTTCTGCCAGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199628360 Original CRISPR CCCCTACCTGGGGCCTCCAG GGG (reversed) Intergenic