ID: 1199630973

View in Genome Browser
Species Human (GRCh38)
Location X:149776424-149776446
Sequence CCAGGCTCACGTCACTCCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199630962_1199630973 15 Left 1199630962 X:149776386-149776408 CCAGTGACCCAGCCGGCCGGCGA 0: 2
1: 0
2: 1
3: 7
4: 66
Right 1199630973 X:149776424-149776446 CCAGGCTCACGTCACTCCGGTGG 0: 2
1: 0
2: 0
3: 4
4: 90
1199630967_1199630973 3 Left 1199630967 X:149776398-149776420 CCGGCCGGCGAGTGGTCAGAGGG 0: 2
1: 0
2: 0
3: 5
4: 63
Right 1199630973 X:149776424-149776446 CCAGGCTCACGTCACTCCGGTGG 0: 2
1: 0
2: 0
3: 4
4: 90
1199630964_1199630973 8 Left 1199630964 X:149776393-149776415 CCCAGCCGGCCGGCGAGTGGTCA 0: 2
1: 0
2: 0
3: 0
4: 35
Right 1199630973 X:149776424-149776446 CCAGGCTCACGTCACTCCGGTGG 0: 2
1: 0
2: 0
3: 4
4: 90
1199630965_1199630973 7 Left 1199630965 X:149776394-149776416 CCAGCCGGCCGGCGAGTGGTCAG 0: 2
1: 0
2: 0
3: 5
4: 61
Right 1199630973 X:149776424-149776446 CCAGGCTCACGTCACTCCGGTGG 0: 2
1: 0
2: 0
3: 4
4: 90
1199630969_1199630973 -1 Left 1199630969 X:149776402-149776424 CCGGCGAGTGGTCAGAGGGCAGC 0: 2
1: 0
2: 1
3: 15
4: 172
Right 1199630973 X:149776424-149776446 CCAGGCTCACGTCACTCCGGTGG 0: 2
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199630973 Original CRISPR CCAGGCTCACGTCACTCCGG TGG Exonic
903576060 1:24340611-24340633 CCAGGCTTACCTCACTCAGCAGG + Intronic
905061420 1:35142875-35142897 CCCTGCTCTGGTCACTCCGGAGG - Intergenic
909555137 1:76945114-76945136 CCAGGCTCAGGTCAATATGGAGG - Intronic
914975154 1:152354445-152354467 CCAGGCTCAGGTCAGTCCTCTGG - Exonic
914975235 1:152355099-152355121 TCAGGCTCAGGTCAGTCCAGTGG - Exonic
914975265 1:152355330-152355352 TCAGGCTCAGGTCAGTCCGCTGG - Exonic
922925464 1:229343261-229343283 CCAGGCACGCGTCACTCTGCAGG + Intronic
1063602261 10:7493043-7493065 ACAGGCTCACCACACTCCAGTGG + Intergenic
1065965270 10:30765737-30765759 CCAGGTTCACGGCCCTCTGGAGG + Intergenic
1068749252 10:60572858-60572880 CCAGGCTCAAATCACTGTGGAGG - Intronic
1069916363 10:71789500-71789522 CCAGGCTCACCTCCCTCCAGAGG + Intronic
1073284009 10:102376303-102376325 CCAGGCTCACGTCATTCTGATGG - Exonic
1074115105 10:110451060-110451082 GCAGCCTTACGTCACTCAGGCGG + Intergenic
1075413669 10:122247339-122247361 CCAGGCCCTCGTCACTGGGGAGG - Intronic
1080818631 11:35783615-35783637 CCAGGCTCCCATTACTCCAGAGG + Intronic
1081665059 11:44911855-44911877 CCAGGATCACCTCTCTCGGGAGG - Intronic
1083202198 11:61127313-61127335 CCAGGCGCAGCTCACTGCGGCGG + Exonic
1088075709 11:105845795-105845817 CCGGGTTCACGTCATTCCTGAGG - Intronic
1091596106 12:1880098-1880120 CCAGGCTGATGTCACTCAGCAGG + Intronic
1097439946 12:59596604-59596626 CCTGGCTCACGGGACTCCGAGGG + Intronic
1103410950 12:120710878-120710900 CCACGCTCACGTAGCTCTGGTGG + Intronic
1103779130 12:123388085-123388107 CGAGGTTCCCGTCACTCTGGTGG - Intronic
1104084208 12:125459262-125459284 CTTGGCTCAAGTCACTCTGGAGG + Intronic
1104203104 12:126610934-126610956 TCAGGCTCAAGTCACTTTGGAGG + Intergenic
1106129187 13:26925483-26925505 CCAGGCTTATGTCAATCCTGGGG + Intergenic
1112336389 13:98520646-98520668 TGAGGCTCACGTCACTCATGAGG - Intronic
1115338801 14:32270475-32270497 CGAGGATCACGTCTCTCAGGGGG + Intergenic
1115556511 14:34548651-34548673 GCAGGCTCTTGTCACTCGGGTGG - Intergenic
1120845635 14:89122588-89122610 CCAGGCTCACTTCTGTCCAGAGG + Intergenic
1122813881 14:104302884-104302906 CCAGGCAGACGGCACTCCTGGGG - Intergenic
1122820855 14:104344094-104344116 CCAGGCTCACATCCCTGGGGAGG + Intergenic
1124005110 15:25789329-25789351 CCAGGCTGACCTCACTTGGGAGG - Intronic
1128135932 15:65263272-65263294 CCAGGCTCAAGTCACTGGTGAGG + Exonic
1129448745 15:75637389-75637411 CCAGTCTCATGTGACTCCAGAGG - Intergenic
1134213854 16:12300682-12300704 CCAGGCACACGTTGCTCCAGCGG + Intronic
1136113965 16:28082957-28082979 CCAGGGCCACCTCCCTCCGGAGG + Intergenic
1145745906 17:27319512-27319534 ACAGGCTCATGTCACCCAGGGGG - Intergenic
1147006242 17:37406582-37406604 CCCGCCTCACCGCACTCCGGAGG + Intronic
1160572214 18:79825999-79826021 CCAGGCCCACGTCTCTATGGGGG - Intergenic
1163211905 19:15847031-15847053 ACAGGCTCACTCCAGTCCGGAGG - Intergenic
1163553803 19:17981613-17981635 CCAGGCTGACGTCACTCTCTGGG + Intronic
1166294258 19:41881232-41881254 CCAGGCTCCCCTCACCCCAGCGG + Exonic
1166303137 19:41923199-41923221 CCAGGCTCACCTCATCCCTGTGG - Intronic
929585579 2:43112191-43112213 CCAAGCTCAAGACACTCCTGTGG + Intergenic
932401473 2:71483504-71483526 CCAGGCTCAGGTCTCACAGGTGG + Intronic
938201580 2:129376948-129376970 CCAGGCTGACCTCACGCGGGTGG - Intergenic
945303312 2:208234902-208234924 CCAGTGTCAGGTCACTCAGGTGG - Intergenic
1169115890 20:3065624-3065646 CCAGGGTGATGTCACTCTGGTGG + Intergenic
1171023582 20:21608573-21608595 CCAGGCTCACGCCCCTCTGCAGG - Intergenic
1175399192 20:58691154-58691176 ACAGGCACACGGCACTCCAGAGG - Exonic
1180296568 22:10942970-10942992 CCAGGCTCAGCTGACTCCAGAGG - Intergenic
1182516192 22:30860493-30860515 CCAGGCTCACTTCGCGCCAGAGG + Intronic
1184472321 22:44702751-44702773 CCAGGCCCGCACCACTCCGGCGG - Intronic
953645683 3:44751965-44751987 CGAGGATCACGTCTCTCAGGGGG + Exonic
954199596 3:49016419-49016441 CCAGGCTCACCTGACTCTGTGGG + Exonic
954699058 3:52442175-52442197 CCAGGCTCACCTCCCCACGGTGG + Exonic
966898053 3:184460473-184460495 CCATGCTCACTTAACTCCTGGGG - Intronic
968588549 4:1446244-1446266 CCGGGCTCCCGTCCCTCCTGTGG - Intergenic
968699708 4:2048742-2048764 CCATGCTCCCCTCACTCCAGAGG + Intergenic
968894115 4:3388728-3388750 CCAGGCTCCTGTCACTGCCGTGG - Intronic
969647241 4:8438908-8438930 CCCTGCTCTGGTCACTCCGGAGG + Intronic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
985667131 5:1187093-1187115 CAAGGCCCACGTCACCCCAGCGG - Intergenic
985885536 5:2674899-2674921 CCAGGCACAGGACACTCAGGTGG - Intergenic
997436067 5:133876570-133876592 CAAGGCTCACGTTACCCAGGTGG - Intergenic
1002528949 5:179832355-179832377 CCAGGCTCACGTGACTCACCAGG - Intronic
1011299978 6:85863761-85863783 CCCTGCTCTGGTCACTCCGGAGG - Intergenic
1018800917 6:167221740-167221762 CCCGGCTCACGTCACCCCCGTGG + Intergenic
1022497539 7:30862440-30862462 CCAGGCACACTGCACTCCAGCGG + Intronic
1025178018 7:56811669-56811691 CCTGCCTCACGGCCCTCCGGAGG - Intergenic
1025178436 7:56813360-56813382 CCTGCCTCACGGCCCTCCGGAGG - Intergenic
1025178866 7:56815102-56815124 CCTGCCTCACGGCCCTCCGGAGG - Intergenic
1025179302 7:56816892-56816914 CCTGCCTCACGGCCCTCCGGAGG - Intergenic
1025179760 7:56818778-56818800 CCTGCCTCACGGCCCTCCGGAGG - Intergenic
1025180209 7:56820616-56820638 CCTGCCTCACGGCCCTCCGGAGG - Intergenic
1025180680 7:56822598-56822620 CCTGCCTCACGGCCCTCCGGAGG - Intergenic
1025181123 7:56824445-56824467 CCTGCCTCACGGCCCTCCGGAGG - Intronic
1025181555 7:56826187-56826209 CCTGCCTCACGGCCCTCCGGAGG - Intronic
1025690363 7:63750793-63750815 CCTGCCTCACGGCCCTCCGGAGG + Intergenic
1025691690 7:63756215-63756237 CCTGCCTCACGGCCCTCCGGAGG + Intergenic
1025692137 7:63758038-63758060 CCTGCCTCACGGCCCTCCGGAGG + Intergenic
1025692999 7:63761540-63761562 CCTGCCTCACGGCCCTCCGGAGG + Intergenic
1025693445 7:63763363-63763385 CCTGCCTCACGGCCCTCCGGAGG + Intergenic
1025693890 7:63765202-63765224 CCTGCCTCACGGCCCTCCGGAGG + Intergenic
1028121404 7:87059684-87059706 CGATGCTCCCGTCACGCCGGAGG + Exonic
1029435445 7:100561724-100561746 CCAGGCTCAGGGCACTGGGGCGG + Intronic
1030065391 7:105655417-105655439 ACGGGCTCACATCACTCTGGGGG + Intronic
1042482305 8:69317960-69317982 CCAGGTTCACATCACTGCTGCGG - Intergenic
1049101326 8:140580904-140580926 CCAGGCTCAGGTCACGCAGTTGG - Intronic
1051151475 9:14084540-14084562 AAATGCTCACGTCACTCCAGGGG + Intronic
1057016563 9:91657584-91657606 CCAGGGTCACTTCACCCCTGTGG + Intronic
1057466230 9:95317200-95317222 CCCGGCTCCCGCCTCTCCGGGGG + Intronic
1061391858 9:130321159-130321181 CCTGGCTCACAGCACTCCTGAGG - Intronic
1187375439 X:18748826-18748848 CCAAGCTCAGGTCTCTCTGGAGG - Intronic
1199608147 X:149592936-149592958 CCAGGCTCACGTCACTCCGGTGG - Exonic
1199630973 X:149776424-149776446 CCAGGCTCACGTCACTCCGGTGG + Exonic