ID: 1199631637

View in Genome Browser
Species Human (GRCh38)
Location X:149781921-149781943
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 2, 1: 0, 2: 1, 3: 21, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199631632_1199631637 1 Left 1199631632 X:149781897-149781919 CCAGGCTTGGGGGCCGGATGTGA 0: 2
1: 4
2: 1
3: 7
4: 147
Right 1199631637 X:149781921-149781943 GTCACTGACGTGCGCACTGGGGG 0: 2
1: 0
2: 1
3: 21
4: 64
1199631626_1199631637 13 Left 1199631626 X:149781885-149781907 CCCAGGGAAGCTCCAGGCTTGGG 0: 2
1: 1
2: 5
3: 30
4: 317
Right 1199631637 X:149781921-149781943 GTCACTGACGTGCGCACTGGGGG 0: 2
1: 0
2: 1
3: 21
4: 64
1199631628_1199631637 12 Left 1199631628 X:149781886-149781908 CCAGGGAAGCTCCAGGCTTGGGG 0: 2
1: 3
2: 6
3: 51
4: 432
Right 1199631637 X:149781921-149781943 GTCACTGACGTGCGCACTGGGGG 0: 2
1: 0
2: 1
3: 21
4: 64
1199631622_1199631637 25 Left 1199631622 X:149781873-149781895 CCCTACTGGCAACCCAGGGAAGC 0: 2
1: 0
2: 2
3: 17
4: 145
Right 1199631637 X:149781921-149781943 GTCACTGACGTGCGCACTGGGGG 0: 2
1: 0
2: 1
3: 21
4: 64
1199631623_1199631637 24 Left 1199631623 X:149781874-149781896 CCTACTGGCAACCCAGGGAAGCT 0: 2
1: 0
2: 5
3: 12
4: 166
Right 1199631637 X:149781921-149781943 GTCACTGACGTGCGCACTGGGGG 0: 2
1: 0
2: 1
3: 21
4: 64
1199631621_1199631637 26 Left 1199631621 X:149781872-149781894 CCCCTACTGGCAACCCAGGGAAG 0: 2
1: 0
2: 2
3: 25
4: 157
Right 1199631637 X:149781921-149781943 GTCACTGACGTGCGCACTGGGGG 0: 2
1: 0
2: 1
3: 21
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900719484 1:4166173-4166195 GTCACTCACATCCACACTGGAGG + Intergenic
900798712 1:4724891-4724913 GTCACTGATGCCCACACTGGAGG + Intronic
903366284 1:22807213-22807235 GTCTCTGACTTGGGCACTGTAGG + Intronic
913134762 1:115877685-115877707 GACCCTGGCGTGTGCACTGGGGG + Intergenic
923355982 1:233156456-233156478 AGCACTGCCGTGAGCACTGGAGG + Intronic
923362334 1:233223930-233223952 GGCACTGATGTTCGAACTGGTGG - Intronic
1072873359 10:99145012-99145034 GTCACTGAAGAGAGCACAGGAGG + Intronic
1075386206 10:122057267-122057289 GGCACTGACTGGTGCACTGGAGG + Intronic
1084653567 11:70502624-70502646 GTCATTGTCGTGGGCTCTGGCGG + Intronic
1085044247 11:73344081-73344103 GGCACTGAGGTGGGCACTGGGGG - Intronic
1085758492 11:79221528-79221550 CTCACTGACGTGCTCTCTGAAGG - Intronic
1089320638 11:117624577-117624599 GGCACTCACATGCGCACTCGTGG + Intronic
1091271380 11:134314044-134314066 ATCACTGAAGTGTGCACTGGGGG - Intronic
1091448948 12:560923-560945 GTCTATGACGTGTGCCCTGGAGG + Intronic
1096434321 12:51575833-51575855 GTCACTGACATGATCACTTGAGG + Intergenic
1102963820 12:117111487-117111509 GTCACTTACTAGCACACTGGAGG - Intergenic
1103172435 12:118833204-118833226 GTCACTGTCGTGGGCAATTGAGG - Intergenic
1105987168 13:25579002-25579024 GTCACTGCCATGGGCACAGGAGG - Intronic
1117316604 14:54577077-54577099 GTCACTGCTGTGGGCAGTGGGGG + Intronic
1117969721 14:61239848-61239870 CTCACTGAAGTCTGCACTGGGGG + Intronic
1122906622 14:104804700-104804722 GTCACTGCCGTTTCCACTGGAGG - Exonic
1124420717 15:29518990-29519012 GTCTCTGAAGTACTCACTGGTGG - Intronic
1132301957 15:100781534-100781556 GTTACTGATGTGTGCACTGTGGG - Intergenic
1154317799 18:13319297-13319319 GTAACAGAGGTGCGCAGTGGCGG + Intronic
1154469203 18:14682207-14682229 GTCACAGACGTGTCCTCTGGAGG - Intergenic
1157271306 18:46278375-46278397 GTCACTGCCATGAGCAATGGGGG - Intergenic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1161238571 19:3209679-3209701 GTCACTGACTTGCCCTCTGCTGG + Intergenic
1161350144 19:3786576-3786598 GTCCCCGCCGCGCGCACTGGCGG - Intronic
1167482941 19:49744355-49744377 TTCACTGAGGAGCGAACTGGAGG - Exonic
1167570644 19:50286574-50286596 GTCACTGACACGGGCACTGGAGG + Exonic
932611582 2:73203562-73203584 TTCACAGACGTGAGCAGTGGAGG - Intronic
934120879 2:88838357-88838379 GTCACTGACGTGCCCCCATGGGG - Intergenic
935046759 2:99489890-99489912 GTCCCTGGCGAGGGCACTGGCGG - Exonic
937066455 2:119021492-119021514 GTCACTGAAGTCAGCACTGGTGG + Intergenic
937292161 2:120788239-120788261 ACCACTGACGTGTGCACAGGTGG + Intronic
937915315 2:127096049-127096071 TTCACTCACTTGCTCACTGGAGG - Intronic
1170582501 20:17710015-17710037 GTTACTGCCATGAGCACTGGGGG + Intronic
1176805305 21:13475448-13475470 GTCACAGACGTGTCCTCTGGAGG + Intergenic
963352767 3:144172588-144172610 ATGACTGAGGTGAGCACTGGGGG - Intergenic
963446103 3:145410017-145410039 ATCACTGAATTGCGTACTGGAGG - Intergenic
968090384 3:195895378-195895400 GTCACTGCCCTGCGTCCTGGGGG + Exonic
970911735 4:21284817-21284839 GTAACCGACGTGAGCACTTGGGG + Intronic
987321954 5:16778536-16778558 GAGCCTGACGTACGCACTGGGGG + Intronic
989120923 5:38003883-38003905 GTCACTGCCGTGCTTACTGGAGG - Intergenic
989352394 5:40501180-40501202 GTCACTTACGTGGGTACTGGAGG - Intergenic
992576043 5:78113820-78113842 CTCACTGTCCTGCTCACTGGAGG + Exonic
998335874 5:141371800-141371822 GGCTCTGACATGCGCAATGGAGG - Exonic
998341165 5:141419265-141419287 GGCACTGACTTGCGCTATGGAGG - Exonic
1000673757 5:164094560-164094582 GTCACTGACGTTCACGCTTGAGG - Intergenic
1001690716 5:173630739-173630761 GGCACTGTGGTGGGCACTGGGGG + Intergenic
1009338356 6:62522907-62522929 TTCACTGAGGTCTGCACTGGTGG - Intergenic
1017823902 6:158067920-158067942 GTCACTTTCGTGGGGACTGGAGG - Intronic
1017857230 6:158360391-158360413 GACACTGACATGTGCACTCGAGG - Intronic
1029220899 7:98989412-98989434 GTCACCCACGTGCTCACTGAAGG + Intronic
1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG + Intronic
1033114701 7:138615082-138615104 TTCAGTGACGTGTGCACTGCTGG - Intronic
1053565252 9:39242633-39242655 GTGACTGACCTGTGCACTGCTGG + Intronic
1053831022 9:42080483-42080505 GTGACTGACCTGTGCACTGCTGG + Intronic
1054131899 9:61376406-61376428 GTGACTGACCTGTGCACTGCTGG - Intergenic
1054599532 9:67106955-67106977 GTGACTGACCTGTGCACTGCTGG - Intergenic
1057422744 9:94925673-94925695 GACACTGATGTGCACACTGCTGG - Intronic
1060408527 9:123384584-123384606 GTGACAGCCGTGCTCACTGGTGG - Intronic
1188126362 X:26374015-26374037 GAGCCTGACTTGCGCACTGGGGG - Intergenic
1197899367 X:131353685-131353707 GTCACTGAAGTGAGCACAAGTGG + Intronic
1198329139 X:135605607-135605629 ATCACGGAAGTGTGCACTGGAGG - Intergenic
1199607188 X:149586446-149586468 GCCTCTGACTTGCGCACTGGGGG - Intronic
1199607486 X:149587446-149587468 GTCACTGACGTGCGCACTGGGGG - Exonic
1199631637 X:149781921-149781943 GTCACTGACGTGCGCACTGGGGG + Exonic
1199631936 X:149782922-149782944 GCCTCTGACTTGCGCACTGGGGG + Intronic
1199872656 X:151912864-151912886 GCCACTGACTTGCGCACTGGGGG + Intronic
1199872812 X:151913484-151913506 GCCACTGACTTGCGCATTGGGGG + Intronic
1199872991 X:151914172-151914194 GCCACTGACTTGCGCATTGGGGG + Intronic
1199873170 X:151914858-151914880 GCCACTGACTTGCGCATTGGGGG + Intronic
1199873346 X:151915535-151915557 GCCACTGACTTGCGCATTGGGGG + Intronic
1199873518 X:151916216-151916238 GCCACTGACTTGCGCATTGGGGG + Intronic
1199873697 X:151916902-151916924 GCCACTGACTTGCGCATTGGGGG + Intronic
1199873873 X:151917579-151917601 GCCACTGACTTGCGCATTGGGGG + Intronic
1199874051 X:151918254-151918276 GCCACTGACTTGCGCATTGGGGG + Exonic
1199874222 X:151918935-151918957 GCCACTGACTTGCGCATTCGGGG + Intronic
1199874399 X:151919618-151919640 GCCACTGACTTGCGCATTGGGGG + Intronic
1199895056 X:152119753-152119775 GCCACTGATTTGCGCATTGGGGG - Intergenic
1199949779 X:152698717-152698739 GCCACTGACTTGCGCATTGGAGG + Intergenic
1199951969 X:152714577-152714599 GCCACTGACTTGCGCATTGGAGG + Exonic
1199954609 X:152733754-152733776 GCCACTGACTTGCGCGTTGGAGG + Intergenic
1199957714 X:152753871-152753893 GCCACTGACTTGCGCATTGGAGG - Intronic
1199959895 X:152769744-152769766 GCCACTGACTTGCGCATTGGAGG - Intronic
1200017733 X:153179259-153179281 GCCACTGACTTGCGCATTGTGGG + Intergenic