ID: 1199632224

View in Genome Browser
Species Human (GRCh38)
Location X:149784036-149784058
Sequence TCCAGGGGGCCTCGTCGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 40}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199632224_1199632232 1 Left 1199632224 X:149784036-149784058 CCAGACCGACGAGGCCCCCTGGA 0: 2
1: 0
2: 0
3: 3
4: 40
Right 1199632232 X:149784060-149784082 CCTGCTCCTTTGGTCAGCCTTGG 0: 2
1: 0
2: 3
3: 31
4: 283
1199632224_1199632233 2 Left 1199632224 X:149784036-149784058 CCAGACCGACGAGGCCCCCTGGA 0: 2
1: 0
2: 0
3: 3
4: 40
Right 1199632233 X:149784061-149784083 CTGCTCCTTTGGTCAGCCTTGGG 0: 2
1: 0
2: 2
3: 32
4: 266
1199632224_1199632227 -9 Left 1199632224 X:149784036-149784058 CCAGACCGACGAGGCCCCCTGGA 0: 2
1: 0
2: 0
3: 3
4: 40
Right 1199632227 X:149784050-149784072 CCCCCTGGAACCTGCTCCTTTGG 0: 2
1: 0
2: 1
3: 17
4: 200
1199632224_1199632236 28 Left 1199632224 X:149784036-149784058 CCAGACCGACGAGGCCCCCTGGA 0: 2
1: 0
2: 0
3: 3
4: 40
Right 1199632236 X:149784087-149784109 CTCATGCATGAGTGACCATGAGG 0: 2
1: 0
2: 0
3: 6
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199632224 Original CRISPR TCCAGGGGGCCTCGTCGGTC TGG (reversed) Intronic
906536967 1:46556417-46556439 TCAAGGGGGCTTCCTGGGTCAGG - Intergenic
907497647 1:54855415-54855437 TCCAAGGGGCCTCCGAGGTCAGG + Intronic
1073101095 10:101007111-101007133 TGCAGGGGGCCTGCTCGGCCAGG - Exonic
1075921449 10:126216716-126216738 CCCAGGGGGCTTCGTAGGTCAGG + Intronic
1077317859 11:1927307-1927329 CCCAGGGGGCCTCCTCACTCCGG - Intronic
1077466840 11:2737394-2737416 TCCAGGGGCCCCCGTGGGTCTGG - Intronic
1080836480 11:35944806-35944828 CCCAGGGCCCCTCGCCGGTCAGG - Intronic
1083222035 11:61258868-61258890 TCCAGGTGGCCTCCTCTGCCTGG - Exonic
1100475967 12:94935575-94935597 TCCAGGGGTCCTTGTAGGCCAGG - Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1120844797 14:89116271-89116293 TCCAGGGGTCCTCGTTGGGAAGG - Intergenic
1125796681 15:42408844-42408866 TCCAGGGCCCCTCTTCTGTCTGG + Intronic
1126368152 15:47917495-47917517 TCCAGGGGGACTCATTGGTCTGG + Intergenic
1136429362 16:30187825-30187847 GCAAGGTGGCCTCGTCGGGCGGG + Exonic
1137671440 16:50281793-50281815 TACTGGGGGCCTCTTAGGTCAGG + Intronic
1147885464 17:43681318-43681340 TCCAGGGGGCCATCTCTGTCAGG + Intergenic
1152073511 17:78145530-78145552 GACCAGGGGCCTCGTCGGTCTGG + Intergenic
1152140599 17:78534288-78534310 TGCAGGGGACCTCGTTGGTAAGG + Intronic
1152727835 17:81956418-81956440 GCCAGGGGGCCTAGTCGCTGCGG - Intronic
1152782238 17:82231518-82231540 TCCAGGAGGCCTCGGAGGTGGGG + Intronic
1161590682 19:5127867-5127889 CCCAGGAGGCCCCGTTGGTCGGG + Intronic
1162919174 19:13890095-13890117 TCCTGGGGGGCTCCTCTGTCTGG + Exonic
1166361179 19:42253674-42253696 CCCAGGGCCCCTCCTCGGTCCGG + Intronic
1167606246 19:50482371-50482393 CCCAGGTGGCCTCGTGGGACGGG - Exonic
935592368 2:104855080-104855102 TCCAGCGGGGCTCGCCGGGCGGG - Intergenic
942302520 2:174575398-174575420 ACCAGGGGGCATAGTCTGTCGGG - Intronic
948207767 2:236171661-236171683 TCCTGCGGGCCTCGAGGGTCTGG + Intergenic
1169488802 20:6054425-6054447 TCCTCGGGGCCTCTTGGGTCTGG - Intergenic
1172800706 20:37574322-37574344 GCCAGCAGGCCTCCTCGGTCTGG - Intergenic
1175394687 20:58650385-58650407 TCCGTGGGGCCGCGTCGGGCAGG - Intergenic
1203237281 22_KI270732v1_random:17472-17494 TCCACGGGGTCTAGTCGGTGGGG - Intergenic
968225586 3:196970035-196970057 GCCAGGGGGCAGCGTCGGGCCGG - Intergenic
968656530 4:1780715-1780737 TCCATGGGCCCTAGACGGTCTGG + Intergenic
1002052161 5:176577286-176577308 TCCATGGGACCTCATCGGGCGGG + Intronic
1011603700 6:89081722-89081744 TCCAGGGGGTTTCGGCGTTCCGG + Intronic
1018552610 6:165015390-165015412 TCCAGGGGGCATCAGGGGTCAGG + Intergenic
1018816855 6:167339567-167339589 TCCAGTGGGCCTGATGGGTCAGG + Intronic
1019927565 7:4203308-4203330 GCCAGGGGGCCTCTGCGGCCTGG - Intronic
1025943984 7:66092568-66092590 TCCCGGAGGCCTCGTGGGCCTGG - Exonic
1033600303 7:142884317-142884339 TCCAGGCAGCCTCCCCGGTCAGG + Intronic
1047538005 8:125736942-125736964 TCCATGAGGCCTCATCTGTCCGG - Intergenic
1061235794 9:129341918-129341940 TCCAGAGGGCCTCGTGGGGAGGG - Intergenic
1062501906 9:136855277-136855299 CCCGGGGGGCGTCGTGGGTCTGG + Exonic
1199606899 X:149585332-149585354 TCCAGGGGGCCTCGTCGGTCTGG + Intronic
1199632224 X:149784036-149784058 TCCAGGGGGCCTCGTCGGTCTGG - Intronic