ID: 1199632979

View in Genome Browser
Species Human (GRCh38)
Location X:149788195-149788217
Sequence GGTGCGCTTGAACACAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199632977_1199632979 -7 Left 1199632977 X:149788179-149788201 CCCGCGCTCTTGTCTCGGTGCGC No data
Right 1199632979 X:149788195-149788217 GGTGCGCTTGAACACAGTGCAGG No data
1199632978_1199632979 -8 Left 1199632978 X:149788180-149788202 CCGCGCTCTTGTCTCGGTGCGCT No data
Right 1199632979 X:149788195-149788217 GGTGCGCTTGAACACAGTGCAGG No data
1199632973_1199632979 23 Left 1199632973 X:149788149-149788171 CCACCTGGGGCAGGAATAGAAGG No data
Right 1199632979 X:149788195-149788217 GGTGCGCTTGAACACAGTGCAGG No data
1199632975_1199632979 20 Left 1199632975 X:149788152-149788174 CCTGGGGCAGGAATAGAAGGAAA No data
Right 1199632979 X:149788195-149788217 GGTGCGCTTGAACACAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199632979 Original CRISPR GGTGCGCTTGAACACAGTGC AGG Intergenic
No off target data available for this crispr