ID: 1199634824

View in Genome Browser
Species Human (GRCh38)
Location X:149805263-149805285
Sequence TATTTGGGGTCTTCCCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199634824_1199634837 17 Left 1199634824 X:149805263-149805285 CCCCAGAGGGAAGACCCCAAATA No data
Right 1199634837 X:149805303-149805325 CTGCCAGCCCTGGACCACCTGGG No data
1199634824_1199634839 19 Left 1199634824 X:149805263-149805285 CCCCAGAGGGAAGACCCCAAATA No data
Right 1199634839 X:149805305-149805327 GCCAGCCCTGGACCACCTGGGGG No data
1199634824_1199634838 18 Left 1199634824 X:149805263-149805285 CCCCAGAGGGAAGACCCCAAATA No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634824_1199634831 7 Left 1199634824 X:149805263-149805285 CCCCAGAGGGAAGACCCCAAATA No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG No data
1199634824_1199634836 16 Left 1199634824 X:149805263-149805285 CCCCAGAGGGAAGACCCCAAATA No data
Right 1199634836 X:149805302-149805324 GCTGCCAGCCCTGGACCACCTGG No data
1199634824_1199634841 22 Left 1199634824 X:149805263-149805285 CCCCAGAGGGAAGACCCCAAATA No data
Right 1199634841 X:149805308-149805330 AGCCCTGGACCACCTGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199634824 Original CRISPR TATTTGGGGTCTTCCCTCTG GGG (reversed) Intergenic