ID: 1199634826

View in Genome Browser
Species Human (GRCh38)
Location X:149805265-149805287
Sequence ATTATTTGGGGTCTTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199634826_1199634836 14 Left 1199634826 X:149805265-149805287 CCAGAGGGAAGACCCCAAATAAT No data
Right 1199634836 X:149805302-149805324 GCTGCCAGCCCTGGACCACCTGG 0: 3
1: 4
2: 5
3: 38
4: 332
1199634826_1199634845 30 Left 1199634826 X:149805265-149805287 CCAGAGGGAAGACCCCAAATAAT No data
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data
1199634826_1199634841 20 Left 1199634826 X:149805265-149805287 CCAGAGGGAAGACCCCAAATAAT No data
Right 1199634841 X:149805308-149805330 AGCCCTGGACCACCTGGGGGCGG No data
1199634826_1199634837 15 Left 1199634826 X:149805265-149805287 CCAGAGGGAAGACCCCAAATAAT No data
Right 1199634837 X:149805303-149805325 CTGCCAGCCCTGGACCACCTGGG No data
1199634826_1199634831 5 Left 1199634826 X:149805265-149805287 CCAGAGGGAAGACCCCAAATAAT No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG 0: 3
1: 3
2: 15
3: 68
4: 486
1199634826_1199634838 16 Left 1199634826 X:149805265-149805287 CCAGAGGGAAGACCCCAAATAAT No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634826_1199634839 17 Left 1199634826 X:149805265-149805287 CCAGAGGGAAGACCCCAAATAAT No data
Right 1199634839 X:149805305-149805327 GCCAGCCCTGGACCACCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199634826 Original CRISPR ATTATTTGGGGTCTTCCCTC TGG (reversed) Intergenic
No off target data available for this crispr