ID: 1199634827

View in Genome Browser
Species Human (GRCh38)
Location X:149805277-149805299
Sequence GGGTGGTGCTGGATTATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199634827_1199634845 18 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data
1199634827_1199634847 24 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634847 X:149805324-149805346 GGGGCGGACTTCTCAGGCTGTGG No data
1199634827_1199634836 2 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634836 X:149805302-149805324 GCTGCCAGCCCTGGACCACCTGG No data
1199634827_1199634841 8 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634841 X:149805308-149805330 AGCCCTGGACCACCTGGGGGCGG No data
1199634827_1199634831 -7 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG No data
1199634827_1199634848 25 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634827_1199634838 4 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634827_1199634837 3 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634837 X:149805303-149805325 CTGCCAGCCCTGGACCACCTGGG No data
1199634827_1199634839 5 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634839 X:149805305-149805327 GCCAGCCCTGGACCACCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199634827 Original CRISPR GGGTGGTGCTGGATTATTTG GGG (reversed) Intergenic