ID: 1199634830

View in Genome Browser
Species Human (GRCh38)
Location X:149805288-149805310
Sequence GCTGGCAGCAGGGGTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199634830_1199634836 -9 Left 1199634830 X:149805288-149805310 CCAGCACCACCCCTGCTGCCAGC No data
Right 1199634836 X:149805302-149805324 GCTGCCAGCCCTGGACCACCTGG No data
1199634830_1199634837 -8 Left 1199634830 X:149805288-149805310 CCAGCACCACCCCTGCTGCCAGC No data
Right 1199634837 X:149805303-149805325 CTGCCAGCCCTGGACCACCTGGG No data
1199634830_1199634841 -3 Left 1199634830 X:149805288-149805310 CCAGCACCACCCCTGCTGCCAGC No data
Right 1199634841 X:149805308-149805330 AGCCCTGGACCACCTGGGGGCGG No data
1199634830_1199634848 14 Left 1199634830 X:149805288-149805310 CCAGCACCACCCCTGCTGCCAGC No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634830_1199634839 -6 Left 1199634830 X:149805288-149805310 CCAGCACCACCCCTGCTGCCAGC No data
Right 1199634839 X:149805305-149805327 GCCAGCCCTGGACCACCTGGGGG No data
1199634830_1199634845 7 Left 1199634830 X:149805288-149805310 CCAGCACCACCCCTGCTGCCAGC No data
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data
1199634830_1199634838 -7 Left 1199634830 X:149805288-149805310 CCAGCACCACCCCTGCTGCCAGC No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634830_1199634847 13 Left 1199634830 X:149805288-149805310 CCAGCACCACCCCTGCTGCCAGC No data
Right 1199634847 X:149805324-149805346 GGGGCGGACTTCTCAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199634830 Original CRISPR GCTGGCAGCAGGGGTGGTGC TGG (reversed) Intergenic