ID: 1199634831

View in Genome Browser
Species Human (GRCh38)
Location X:149805293-149805315
Sequence ACCACCCCTGCTGCCAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199634828_1199634831 -8 Left 1199634828 X:149805278-149805300 CCCAAATAATCCAGCACCACCCC No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG No data
1199634822_1199634831 11 Left 1199634822 X:149805259-149805281 CCCGCCCCAGAGGGAAGACCCCA No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG No data
1199634824_1199634831 7 Left 1199634824 X:149805263-149805285 CCCCAGAGGGAAGACCCCAAATA No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG No data
1199634826_1199634831 5 Left 1199634826 X:149805265-149805287 CCAGAGGGAAGACCCCAAATAAT No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG No data
1199634827_1199634831 -7 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG No data
1199634821_1199634831 12 Left 1199634821 X:149805258-149805280 CCCCGCCCCAGAGGGAAGACCCC No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG No data
1199634829_1199634831 -9 Left 1199634829 X:149805279-149805301 CCAAATAATCCAGCACCACCCCT No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG No data
1199634820_1199634831 13 Left 1199634820 X:149805257-149805279 CCCCCGCCCCAGAGGGAAGACCC No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG No data
1199634823_1199634831 10 Left 1199634823 X:149805260-149805282 CCGCCCCAGAGGGAAGACCCCAA No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG No data
1199634825_1199634831 6 Left 1199634825 X:149805264-149805286 CCCAGAGGGAAGACCCCAAATAA No data
Right 1199634831 X:149805293-149805315 ACCACCCCTGCTGCCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199634831 Original CRISPR ACCACCCCTGCTGCCAGCCC TGG Intergenic