ID: 1199634832

View in Genome Browser
Species Human (GRCh38)
Location X:149805294-149805316
Sequence TCCAGGGCTGGCAGCAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 798
Summary {0: 3, 1: 4, 2: 8, 3: 95, 4: 688}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199634832_1199634848 8 Left 1199634832 X:149805294-149805316 CCACCCCTGCTGCCAGCCCTGGA 0: 3
1: 4
2: 8
3: 95
4: 688
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634832_1199634845 1 Left 1199634832 X:149805294-149805316 CCACCCCTGCTGCCAGCCCTGGA 0: 3
1: 4
2: 8
3: 95
4: 688
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data
1199634832_1199634841 -9 Left 1199634832 X:149805294-149805316 CCACCCCTGCTGCCAGCCCTGGA 0: 3
1: 4
2: 8
3: 95
4: 688
Right 1199634841 X:149805308-149805330 AGCCCTGGACCACCTGGGGGCGG No data
1199634832_1199634847 7 Left 1199634832 X:149805294-149805316 CCACCCCTGCTGCCAGCCCTGGA 0: 3
1: 4
2: 8
3: 95
4: 688
Right 1199634847 X:149805324-149805346 GGGGCGGACTTCTCAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199634832 Original CRISPR TCCAGGGCTGGCAGCAGGGG TGG (reversed) Intergenic