ID: 1199634838

View in Genome Browser
Species Human (GRCh38)
Location X:149805304-149805326
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199634826_1199634838 16 Left 1199634826 X:149805265-149805287 CCAGAGGGAAGACCCCAAATAAT No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634822_1199634838 22 Left 1199634822 X:149805259-149805281 CCCGCCCCAGAGGGAAGACCCCA No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634820_1199634838 24 Left 1199634820 X:149805257-149805279 CCCCCGCCCCAGAGGGAAGACCC No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634829_1199634838 2 Left 1199634829 X:149805279-149805301 CCAAATAATCCAGCACCACCCCT 0: 1
1: 2
2: 15
3: 27
4: 222
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634824_1199634838 18 Left 1199634824 X:149805263-149805285 CCCCAGAGGGAAGACCCCAAATA No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634830_1199634838 -7 Left 1199634830 X:149805288-149805310 CCAGCACCACCCCTGCTGCCAGC No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634827_1199634838 4 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634828_1199634838 3 Left 1199634828 X:149805278-149805300 CCCAAATAATCCAGCACCACCCC No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634821_1199634838 23 Left 1199634821 X:149805258-149805280 CCCCGCCCCAGAGGGAAGACCCC No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634825_1199634838 17 Left 1199634825 X:149805264-149805286 CCCAGAGGGAAGACCCCAAATAA 0: 1
1: 0
2: 2
3: 31
4: 168
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data
1199634823_1199634838 21 Left 1199634823 X:149805260-149805282 CCGCCCCAGAGGGAAGACCCCAA No data
Right 1199634838 X:149805304-149805326 TGCCAGCCCTGGACCACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199634838 Original CRISPR TGCCAGCCCTGGACCACCTG GGG Intergenic