ID: 1199634845

View in Genome Browser
Species Human (GRCh38)
Location X:149805318-149805340
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199634827_1199634845 18 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data
1199634828_1199634845 17 Left 1199634828 X:149805278-149805300 CCCAAATAATCCAGCACCACCCC No data
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data
1199634834_1199634845 -3 Left 1199634834 X:149805298-149805320 CCCTGCTGCCAGCCCTGGACCAC No data
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data
1199634832_1199634845 1 Left 1199634832 X:149805294-149805316 CCACCCCTGCTGCCAGCCCTGGA No data
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data
1199634829_1199634845 16 Left 1199634829 X:149805279-149805301 CCAAATAATCCAGCACCACCCCT No data
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data
1199634833_1199634845 -2 Left 1199634833 X:149805297-149805319 CCCCTGCTGCCAGCCCTGGACCA No data
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data
1199634826_1199634845 30 Left 1199634826 X:149805265-149805287 CCAGAGGGAAGACCCCAAATAAT No data
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data
1199634835_1199634845 -4 Left 1199634835 X:149805299-149805321 CCTGCTGCCAGCCCTGGACCACC No data
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data
1199634830_1199634845 7 Left 1199634830 X:149805288-149805310 CCAGCACCACCCCTGCTGCCAGC No data
Right 1199634845 X:149805318-149805340 CACCTGGGGGCGGACTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199634845 Original CRISPR CACCTGGGGGCGGACTTCTC AGG Intergenic