ID: 1199634848

View in Genome Browser
Species Human (GRCh38)
Location X:149805325-149805347
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199634835_1199634848 3 Left 1199634835 X:149805299-149805321 CCTGCTGCCAGCCCTGGACCACC No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634840_1199634848 -4 Left 1199634840 X:149805306-149805328 CCAGCCCTGGACCACCTGGGGGC No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634842_1199634848 -8 Left 1199634842 X:149805310-149805332 CCCTGGACCACCTGGGGGCGGAC No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634829_1199634848 23 Left 1199634829 X:149805279-149805301 CCAAATAATCCAGCACCACCCCT No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634830_1199634848 14 Left 1199634830 X:149805288-149805310 CCAGCACCACCCCTGCTGCCAGC No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634827_1199634848 25 Left 1199634827 X:149805277-149805299 CCCCAAATAATCCAGCACCACCC No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634832_1199634848 8 Left 1199634832 X:149805294-149805316 CCACCCCTGCTGCCAGCCCTGGA No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634828_1199634848 24 Left 1199634828 X:149805278-149805300 CCCAAATAATCCAGCACCACCCC No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634834_1199634848 4 Left 1199634834 X:149805298-149805320 CCCTGCTGCCAGCCCTGGACCAC No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634833_1199634848 5 Left 1199634833 X:149805297-149805319 CCCCTGCTGCCAGCCCTGGACCA No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data
1199634843_1199634848 -9 Left 1199634843 X:149805311-149805333 CCTGGACCACCTGGGGGCGGACT No data
Right 1199634848 X:149805325-149805347 GGGCGGACTTCTCAGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199634848 Original CRISPR GGGCGGACTTCTCAGGCTGT GGG Intergenic