ID: 1199634885

View in Genome Browser
Species Human (GRCh38)
Location X:149805461-149805483
Sequence CAAGGTCAGGATTCTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199634871_1199634885 29 Left 1199634871 X:149805409-149805431 CCAGGGCAGGGCTGGTTAGGAGA 0: 3
1: 6
2: 13
3: 29
4: 265
Right 1199634885 X:149805461-149805483 CAAGGTCAGGATTCTGAGGGAGG No data
1199634879_1199634885 -3 Left 1199634879 X:149805441-149805463 CCAGGCTCTGCCAGGCATAACAA No data
Right 1199634885 X:149805461-149805483 CAAGGTCAGGATTCTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199634885 Original CRISPR CAAGGTCAGGATTCTGAGGG AGG Intergenic
No off target data available for this crispr