ID: 1199646422

View in Genome Browser
Species Human (GRCh38)
Location X:149917720-149917742
Sequence CAGGGTCCCCAAAATGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199646409_1199646422 28 Left 1199646409 X:149917669-149917691 CCTAATCTGAAATTCCCTGGAGT No data
Right 1199646422 X:149917720-149917742 CAGGGTCCCCAAAATGAAATGGG No data
1199646414_1199646422 14 Left 1199646414 X:149917683-149917705 CCCTGGAGTGGGAGACGGAAGGG No data
Right 1199646422 X:149917720-149917742 CAGGGTCCCCAAAATGAAATGGG No data
1199646416_1199646422 13 Left 1199646416 X:149917684-149917706 CCTGGAGTGGGAGACGGAAGGGA No data
Right 1199646422 X:149917720-149917742 CAGGGTCCCCAAAATGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199646422 Original CRISPR CAGGGTCCCCAAAATGAAAT GGG Intergenic
No off target data available for this crispr