ID: 1199649386

View in Genome Browser
Species Human (GRCh38)
Location X:149938389-149938411
Sequence CGCTTACTCCCGGAAACCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199649380_1199649386 9 Left 1199649380 X:149938357-149938379 CCCGGCTCGTGTCAGGGCTGTAA 0: 1
1: 0
2: 1
3: 4
4: 70
Right 1199649386 X:149938389-149938411 CGCTTACTCCCGGAAACCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 50
1199649376_1199649386 30 Left 1199649376 X:149938336-149938358 CCGCGGTGAGAAGAGAGAGCACC 0: 1
1: 0
2: 1
3: 11
4: 181
Right 1199649386 X:149938389-149938411 CGCTTACTCCCGGAAACCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 50
1199649381_1199649386 8 Left 1199649381 X:149938358-149938380 CCGGCTCGTGTCAGGGCTGTAAG 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1199649386 X:149938389-149938411 CGCTTACTCCCGGAAACCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199649386 Original CRISPR CGCTTACTCCCGGAAACCGG TGG Exonic
912850782 1:113122164-113122186 CGCTTGAACCCGGAAAGCGGAGG - Intronic
915497738 1:156293498-156293520 GGCTTACTCCCAGAAGCCGGGGG - Exonic
916048637 1:161019509-161019531 CGCTTAAACCCGGAAGGCGGAGG + Intronic
1063154279 10:3364300-3364322 CGCTTAAACCCGGGAAGCGGAGG - Intergenic
1068726906 10:60313165-60313187 CGCTTACTCCCAGGACCCTGCGG + Intronic
1072113237 10:92343651-92343673 CGCTTGAACCCGGAAAGCGGAGG - Intronic
1073747902 10:106490956-106490978 AGCTGAATCCCTGAAACCGGTGG + Intergenic
1092385109 12:8031196-8031218 CGCTTGAACCCGGAAAGCGGTGG - Intergenic
1109547208 13:63844461-63844483 CACTTACTCCCCGAAACGCGGGG - Intergenic
1115453238 14:33572937-33572959 CGCTTAACCCCGGGAAGCGGAGG + Intronic
1116851537 14:49914051-49914073 CGCTTAAACCCGGGAAGCGGAGG - Intergenic
1118394361 14:65323063-65323085 CGCTTGATCCCGGAAGGCGGAGG + Intergenic
1119204797 14:72786177-72786199 CGCTTAAACCCGGGAAGCGGAGG + Intronic
1119425729 14:74533678-74533700 CGCATCCCCCCGGAAACCCGTGG + Intronic
1121291973 14:92783375-92783397 CGCTTAAACCCGGAAGGCGGAGG + Intergenic
1125673129 15:41487543-41487565 CTATCACTCCCGGAAACGGGCGG + Intergenic
1130337342 15:82967791-82967813 CACTTGCACCCGGAAAGCGGAGG + Intronic
1132726072 16:1338890-1338912 CTCTTTCTCCAGGAAACCCGGGG + Exonic
1135266498 16:21031144-21031166 CGCTTGCTCCCGGAAAGCATTGG + Exonic
1143067560 17:4262343-4262365 CGCTTGAACCCGGAAAACGGAGG - Intronic
1147989937 17:44326445-44326467 CGCTTAAACCCGGAAGGCGGAGG + Intergenic
1152896913 17:82917101-82917123 CGCTTAATCCCGGGAGGCGGAGG - Intronic
1154367460 18:13724855-13724877 CGCTTAAACCCGGAAGGCGGAGG - Intronic
1158505688 18:58044450-58044472 CGCTTCCTCCCGGAAGGCTGCGG - Exonic
1161003795 19:1924529-1924551 CTCTTGCTCCCGGAAACGTGTGG + Exonic
1166789498 19:45390172-45390194 CGCTTAAACCCGGAAGGCGGAGG - Intronic
1168214667 19:54916786-54916808 CGCTTGAACCCGGAAAGCGGAGG - Intergenic
1168227328 19:55005101-55005123 CGCTTAAACCCGGAAGGCGGAGG + Intergenic
927931713 2:27049900-27049922 CGCTTACTCTCGGAAATCTTGGG - Intronic
940226786 2:151409328-151409350 CGCTTAAACCCGGGAAGCGGAGG - Intergenic
941828818 2:169930759-169930781 GGCTTAGTCCCCGAAACCAGAGG - Intronic
947420673 2:229939135-229939157 CGCTTGAACCCGGGAACCGGAGG - Intronic
1172911649 20:38413884-38413906 CGCTTGAACCCGGAAAGCGGAGG + Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1184628068 22:45753487-45753509 CGCTTAATCCCGGGAGGCGGAGG - Intronic
959914011 3:111795806-111795828 CGCTTGATCCCGGGAAGCGGAGG - Intronic
970119844 4:12741498-12741520 CGCTTGAACCCGGGAACCGGAGG - Intergenic
974448166 4:62013802-62013824 CGCTTGAACCCGGAAAGCGGAGG + Intronic
987093119 5:14524980-14525002 CGCTTGATCCCGGAAGGCGGAGG + Intronic
998249925 5:140545636-140545658 CGCTTAAACCCGGGAATCGGAGG + Intronic
1003701583 6:8471815-8471837 CCCTTACTCTCGGTACCCGGAGG + Intergenic
1007607117 6:43125086-43125108 CGCTTGATCCCGGGAAGCGGAGG + Intronic
1013210185 6:107979987-107980009 CGCTTAAACCCGGAAGACGGAGG - Intergenic
1019536332 7:1531376-1531398 CGCTTCCTCCCGGTGACGGGCGG + Intronic
1032183729 7:129705372-129705394 CGCTTAATCCCGGGAGGCGGAGG - Intronic
1034190870 7:149212662-149212684 CGCTTAAACCCGGGAAACGGAGG - Intronic
1035229955 7:157458981-157459003 CGCTTAAACCCGGAAGGCGGAGG - Intergenic
1037811407 8:22089219-22089241 CGCTTTCGCCCGGGAGCCGGGGG + Exonic
1056341463 9:85637123-85637145 CGCTTAATCCCGGGAGCTGGAGG - Intronic
1057102019 9:92370562-92370584 CGCTTGAACCCGGAAAGCGGAGG - Intronic
1190545694 X:51523991-51524013 CGCTTGAACCCGGGAACCGGAGG + Intergenic
1191839383 X:65500509-65500531 CGCTTAAACCCGGGAAGCGGAGG - Intronic
1199600998 X:149541046-149541068 CGCTAACTCCGGGAAACCAGTGG - Exonic
1199649386 X:149938389-149938411 CGCTTACTCCCGGAAACCGGTGG + Exonic