ID: 1199655517

View in Genome Browser
Species Human (GRCh38)
Location X:149991212-149991234
Sequence CCACCTAACTATAGGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199655517_1199655523 13 Left 1199655517 X:149991212-149991234 CCAAGCTTCCTATAGTTAGGTGG No data
Right 1199655523 X:149991248-149991270 GGTCTGGCCAATGAGCTGTGAGG No data
1199655517_1199655522 -3 Left 1199655517 X:149991212-149991234 CCAAGCTTCCTATAGTTAGGTGG No data
Right 1199655522 X:149991232-149991254 TGGGATCATATGATTAGGTCTGG No data
1199655517_1199655521 -8 Left 1199655517 X:149991212-149991234 CCAAGCTTCCTATAGTTAGGTGG No data
Right 1199655521 X:149991227-149991249 TTAGGTGGGATCATATGATTAGG No data
1199655517_1199655524 14 Left 1199655517 X:149991212-149991234 CCAAGCTTCCTATAGTTAGGTGG No data
Right 1199655524 X:149991249-149991271 GTCTGGCCAATGAGCTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199655517 Original CRISPR CCACCTAACTATAGGAAGCT TGG (reversed) Intergenic
No off target data available for this crispr