ID: 1199655520

View in Genome Browser
Species Human (GRCh38)
Location X:149991220-149991242
Sequence ATATGATCCCACCTAACTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199655520_1199655528 30 Left 1199655520 X:149991220-149991242 CCTATAGTTAGGTGGGATCATAT No data
Right 1199655528 X:149991273-149991295 AAATTACCTGTGACACTTTGGGG No data
1199655520_1199655526 28 Left 1199655520 X:149991220-149991242 CCTATAGTTAGGTGGGATCATAT No data
Right 1199655526 X:149991271-149991293 GAAAATTACCTGTGACACTTTGG No data
1199655520_1199655523 5 Left 1199655520 X:149991220-149991242 CCTATAGTTAGGTGGGATCATAT No data
Right 1199655523 X:149991248-149991270 GGTCTGGCCAATGAGCTGTGAGG No data
1199655520_1199655527 29 Left 1199655520 X:149991220-149991242 CCTATAGTTAGGTGGGATCATAT No data
Right 1199655527 X:149991272-149991294 AAAATTACCTGTGACACTTTGGG No data
1199655520_1199655524 6 Left 1199655520 X:149991220-149991242 CCTATAGTTAGGTGGGATCATAT No data
Right 1199655524 X:149991249-149991271 GTCTGGCCAATGAGCTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199655520 Original CRISPR ATATGATCCCACCTAACTAT AGG (reversed) Intergenic
No off target data available for this crispr