ID: 1199655521 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:149991227-149991249 |
| Sequence | TTAGGTGGGATCATATGATT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199655515_1199655521 | 19 | Left | 1199655515 | X:149991185-149991207 | CCTTCTGAAAGCATGAAAGACTA | No data | ||
| Right | 1199655521 | X:149991227-149991249 | TTAGGTGGGATCATATGATTAGG | No data | ||||
| 1199655517_1199655521 | -8 | Left | 1199655517 | X:149991212-149991234 | CCAAGCTTCCTATAGTTAGGTGG | No data | ||
| Right | 1199655521 | X:149991227-149991249 | TTAGGTGGGATCATATGATTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199655521 | Original CRISPR | TTAGGTGGGATCATATGATT AGG | Intergenic | ||
| No off target data available for this crispr | |||||