ID: 1199655522

View in Genome Browser
Species Human (GRCh38)
Location X:149991232-149991254
Sequence TGGGATCATATGATTAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199655515_1199655522 24 Left 1199655515 X:149991185-149991207 CCTTCTGAAAGCATGAAAGACTA No data
Right 1199655522 X:149991232-149991254 TGGGATCATATGATTAGGTCTGG No data
1199655517_1199655522 -3 Left 1199655517 X:149991212-149991234 CCAAGCTTCCTATAGTTAGGTGG No data
Right 1199655522 X:149991232-149991254 TGGGATCATATGATTAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199655522 Original CRISPR TGGGATCATATGATTAGGTC TGG Intergenic
No off target data available for this crispr