ID: 1199655523

View in Genome Browser
Species Human (GRCh38)
Location X:149991248-149991270
Sequence GGTCTGGCCAATGAGCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199655517_1199655523 13 Left 1199655517 X:149991212-149991234 CCAAGCTTCCTATAGTTAGGTGG No data
Right 1199655523 X:149991248-149991270 GGTCTGGCCAATGAGCTGTGAGG No data
1199655520_1199655523 5 Left 1199655520 X:149991220-149991242 CCTATAGTTAGGTGGGATCATAT No data
Right 1199655523 X:149991248-149991270 GGTCTGGCCAATGAGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199655523 Original CRISPR GGTCTGGCCAATGAGCTGTG AGG Intergenic
No off target data available for this crispr