ID: 1199655525

View in Genome Browser
Species Human (GRCh38)
Location X:149991255-149991277
Sequence AATTTTCCCTCACAGCTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199655525_1199655528 -5 Left 1199655525 X:149991255-149991277 CCAATGAGCTGTGAGGGAAAATT No data
Right 1199655528 X:149991273-149991295 AAATTACCTGTGACACTTTGGGG No data
1199655525_1199655526 -7 Left 1199655525 X:149991255-149991277 CCAATGAGCTGTGAGGGAAAATT No data
Right 1199655526 X:149991271-149991293 GAAAATTACCTGTGACACTTTGG No data
1199655525_1199655527 -6 Left 1199655525 X:149991255-149991277 CCAATGAGCTGTGAGGGAAAATT No data
Right 1199655527 X:149991272-149991294 AAAATTACCTGTGACACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199655525 Original CRISPR AATTTTCCCTCACAGCTCAT TGG (reversed) Intergenic
No off target data available for this crispr