ID: 1199655526

View in Genome Browser
Species Human (GRCh38)
Location X:149991271-149991293
Sequence GAAAATTACCTGTGACACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199655520_1199655526 28 Left 1199655520 X:149991220-149991242 CCTATAGTTAGGTGGGATCATAT No data
Right 1199655526 X:149991271-149991293 GAAAATTACCTGTGACACTTTGG No data
1199655525_1199655526 -7 Left 1199655525 X:149991255-149991277 CCAATGAGCTGTGAGGGAAAATT No data
Right 1199655526 X:149991271-149991293 GAAAATTACCTGTGACACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199655526 Original CRISPR GAAAATTACCTGTGACACTT TGG Intergenic
No off target data available for this crispr