ID: 1199655527

View in Genome Browser
Species Human (GRCh38)
Location X:149991272-149991294
Sequence AAAATTACCTGTGACACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199655525_1199655527 -6 Left 1199655525 X:149991255-149991277 CCAATGAGCTGTGAGGGAAAATT No data
Right 1199655527 X:149991272-149991294 AAAATTACCTGTGACACTTTGGG No data
1199655520_1199655527 29 Left 1199655520 X:149991220-149991242 CCTATAGTTAGGTGGGATCATAT No data
Right 1199655527 X:149991272-149991294 AAAATTACCTGTGACACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199655527 Original CRISPR AAAATTACCTGTGACACTTT GGG Intergenic
No off target data available for this crispr